 Methods and compositions for expression of transgenes in plants
专利摘要:
Methods and compositions for the expression of transgenes in monocot plants including maize are disclosed. In the invention, gene silencing is avoided by use of monocot-homeologous sequences from plants of the genus Coix for transformation. Included in these transgene sequences are Coix promoters, enhancers, coding sequences and terminators. Suitable alternatives to maize-derived transgenes are desirable for expression in maize in that homology-based gene silencing can limit or effectively eliminate transgene expression. 公开号:KR20010052350A 申请号:KR1020007012725 申请日:1999-05-14 公开日:2001-06-25 发明作者:알란 엘 크리츠；마이클 에이취 루페티；데일 에이 보이리스 申请人:데칼브 제네틱스 코오퍼레이션； IPC主号:
专利说明:
METHODS AND COMPOSITIONS FOR EXPRESSION OF TRANSGENES IN PLANTS 2. Description of related technology Significant advances in molecular biology have recently led scientists to dramatically increase their ability to control the germplasm of animals and plants. For example, genes that regulate specific genotypes, such as genes that confer antibiotic and insecticide resistance to insects, have been placed in and isolated from specific germplasm. More important is the ability to take genes isolated from one organism and introduce them into another. Such transformation is possible even when a recipient organism is obtained from an animal phylum, genus, or species that is different from that of receiving the gene (heterologous transformation). Attempts have been made to genetically engineer plant genomes to desired characteristics by introducing exogenous genes using a variety of genetic engineering techniques. Agrobacterium infection (Nester et al., 1984), polyethylene glycol (PEG) -mediated DNA uptake (Lorz et al., 1985), plasma electroporation (Fromm et al., 1986), microtome In many ways, including bombardment of objects (Klein et al., 1987), the receiving plant cells can take on new DNA. Although plants have been transformed almost routinely using some of the techniques described above, expressing exogenous DNA is somewhat problematic. One of the most serious problems encountered is a phenomenon known as "co-suppression." The term was first described in Chalcon synthase (CHS) in Petunia as a coinword describing the inhibition of gene expression of exogenous genes after introduction of homologous exogenous transgenes (Jorgensen, 1990). (Napoli et al., 1990; Van der Krol et al., 1990). However, such co-inhibition is not a feature found only in CHS, but is a common phenomenon found in transformed plants. Co-inhibition appears to varying degrees in individual transformants, but in some plants it occurs to the extent that an invalid phenotype is produced at the relevant site. In many transformed plant systems, homogeneity-dependent "gene silencing" has emerged, which involves at least partially homologous exogenous transgene (s) and multiple copies of homologous endogenous sequences. (Jorgensen, 1995; Matzke and Matzke, 1995; Meyer, 1995). The most basic feature that distinguishes the various silences is whether the observed inactivity occurs at the transcriptional or post-transcriptional level, and whether the homology between the interacting sequences can be determined. Promoterity usually results in transcriptional silencing (Neuhuber et al., 1994). Promoter homology-dependent gene silencing interferes with transcription and, in some cases, causes abnormal-mutation, leading to genetic changes in gene expression or DNA modification that persists after isolation of foreign transgenes (Lindbo et. al., 1993; Jorgensen, 1995; Matzke and Matzke, 1995; Park et al., 1996). The cause of this change in gene expression is not yet known, but it is known that silencing is affected by homology length and the position of the interaction sequence. In the case of the nopaline synthase promoter, the 300bp homology portion was found to be able to sufficiently regulate co-inhibition in tobacco (Matzke et al., 1993). The endogenous sequence, also known as H 2 , having a homologous moiety to the nopaline synthase promoter, is a potent gene silencer driven by the nopaline synthase promoter (Matzke et al., 1993; Matzke et al., 1994). This appears to be related to the pairing of the nopaline synthase promoters at the silent and target positions and imposing methylation on the target copy to a degree similar to that obtained autonomously by the silencer (Matzke et al., 1994). The most effective example of co-inhibition is a tobacco strain carrying an exogenous transgene insert having two genes, each driven by the 19S and 35S promoters of CaMV. These two genes linked to two promoters are inhibited and this position trans-inactivates the newly introduced construct providing a common homology portion of at least 90 bp (Vaucheret, 1993). Transcription silencing is particularly problematic in agricultural biotechnology, where most of the promoters most useful for the expression of specific foreign genes are unique to the host genome. The same is true for corn, one of the most important things in agriculture. Some maize promoters with desired expression profiles include tissue-specific such as constituent maize promoters (Walker et al., 1987; Yang and Russell, 1990), maize zein and light harvesting complex promoters, such as those of the Adh and sucrose synthase genes. Conventional promoters (Conkling et al., 1990; Simpson, 1986), inducible promoters such as corn heat shock protein (Odell et al., 1985), and the like. Therefore, there is an urgent need in the art for improved methods of expressing endogenous genes in plants, particularly agriculturally important monocotyledonous plants such as corn. In particular, there is a need for a way for scientists to develop desired characteristics of monocot promoters while avoiding problems associated with co-inhibition of homologous sequences. The lack of suitable alternatives to promoters inherent in agriculturally important monocotyledons is a limitation of current technology. Summary of the Invention Accordingly, the present invention provides a method of expressing a gene in one particular monocotyledonous plant, the method comprising (a) providing a selected gene; (b) preparing a construct consisting of the gene linked to a Coix promoter; (c) transforming the receptive monocotyledonous cells using such constructs; (d) regenerating the monocotyledonous plant expressing the gene. The transformation step includes any method of stably transforming plants, including bombardment of microprojectiles, PEG mediated plasma transformation, electroporation, silicon carbide fiber mediated transformation or Agrobacterium-mediated transformation Etc. are included. In a suitable embodiment of the present invention, the transforming step consists of bombardment of the microprojectiles comprising coating the microprojectiles with DNA consisting of the constructs and contacting the microprojections with the recipient cells. It can be any gene that is desired to be expressed in the transformed plant, for example insect resistance genes, disease resistance genes, insecticide resistance genes, genes affecting grain composition or quality, genes using nutrients, screenable marker genes , Negative selectable marker genes, genes affecting the agronomic characteristics of the plant, and environmental or stress resistant genes. In certain embodiments of the invention, the promoter of Coix is a gamma agent, oleosine ole16, globulin1, actin1, actin c1, stroz synthase, INOPS, EMB5, globulin2, b-32, ADPG-pyrophosphorilla LTP1, Ltp2, Oleosin ole17, Oleosin ole18, Actin 2, Pollen specific protein, Pollen specific pectate lytic enzyme, Anther specific protein, Anther specific gene RTS2, Pollen specific gene, Carpet tissue specific Gene RAB24, anthranilate synthase alpha subunit, alpha zein, anthranilate synthase beta subunit, dihydrodipicolinate synthase, Thi1, alcohol dehydrogenase, cab binding protein, H3C4, RUBISCO SS starch branching enzyme , ACCase, Actin 3, Actin 7, Regulatory Protein GF'14-12, Ribosome Protein L9, Cellulose Biosynthetic Enzyme, S-Adenosyl-L- Homocysteine Hydrolase, Superoxide Dismutase, C-Kina My Receptor, phosphoglycerate mutase, root-specific RCc3 mRNA, glucose-6-phosphate isomerase, pyrophosphate-furactose 6-phosphate 1 phosphotransferase, ubiquinone, beta-ketoacyl-ACP Synthetase, 33kDa Photosystem II, Oxygen-releasing Protein, 69kDa Fear ATPase Subunit, Metallothione-type Protein, Glyceraldehyde-3-Phosphate Dihydrogenase, ABA- and Mature Inducible Analogue Protein, Phenylalanine Ammonia Dissolving Enzyme, Adenosine Triphosphate S-adenosyl-L-homocysteine hydrase, α-tubulin, cab, PEPCase, R, lectin, light harvesting complex, heat shock protein, chalcone synthase, zein, globulin-1, auxin-binding protein, UDP glucose flavonoid glycosyl-transferase gene, a promoter of genes selected from MPI, oleosin, actin, opac 2, b70 and the like. Coix promoter is a gamma coixin promoter. In another aspect, the present invention provides a method for preparing monocotyledonous plants, the method comprising: (a) preparing monocotyledonous plants according to the method described above; (b) provide a method of producing offspring using a method comprising the plant itself or a step of crossing the plant with a second plant. In another aspect, there is provided a method of improving a plant, which comprises: (a) obtaining plant generation of any generation of monocotyledonous plants prepared according to the methods described above; (b) characterized in that it consists of crossing with the plant itself or with the second plant. In another embodiment, the present invention provides a method for preventing gene silencing in monocotyledonous plants; (a) identifying a Coix promoter homologous to a promoter of monocotyledonous plants; Clone the Coix promoter; (c) preparing a construct consisting of a Coix promoter linked to a selected gene; (d) transduce the construct into the acceptor cells of the monocotyledonous cells; (e) regenerating plants that express genes from recipient cells. The monocotyledonous plant can be any monocotyledonous plant, including rice, wheat, barley, rye, sugar cane and corn. In one embodiment of the invention the monocotyledonous plant is corn. The transformation step consists of any method of introducing DNA into the plant genome, eg, bombardment of microprojectiles, PEG mediated protoplast transformation, electroporation, silicon carbide fiber mediated transformation or Agrobacterium-mediated transformation And the like. In a suitable embodiment of the present invention, the transforming step consists of bombardment of the microprojectiles comprising coating the microprojectiles with DNA consisting of the constructs and contacting the microprojections with the recipient cells. Selected genes include insect resistance genes, disease resistance genes (bacteria, viruses, fungi or nematodes), insecticide resistance genes, genes affecting grain composition or quality, genes using nutrients, screenable marker genes, negative selective marker genes These include genes that affect the agricultural characteristics of plants, and environmental or stress-resistant genes. In certain embodiments of the invention, the promoter is gamma zein, oleosine ole16, globulin 1, actin 1, actin c1, stroz synthase, INOPS, EMB5, globulin 2, b-32, ADPG-pyrophosphorylase, Ltp1, Ltp2, Oleosin ole17, Oleosin ole18, Actin2, Pollen specific protein, Pollen specific pectate lytic enzyme, Anther specific protein, Anther specific gene RTS2, Pollen specific gene, Carpet tissue specific gene RAB24 , Anthranilate synthase alpha subunit, alpha zein, anthranilate synthase beta subunit, dihydrodipicolinate synthase, Thi1, alcohol dehydrogenase, cab binding protein, H3C4, RUBISCO SS starch branching enzyme, ACCase , Actin 3, actin 7, regulatory protein GF'14-12, ribosomal protein L9, cellulose biosynthesis enzyme, S-adenosyl-L-homocysteine hydrolase, superoxide dismutase, C-kinase receptor , Phosphoglycerate mutase, root-specific RCc3 mRNA, glucose-6-phosphate isomerase, pyrophosphate-furactose 6-phosphate 1 phosphotransferase, ubiquinone, beta-ketoacyl-ACP synthesis Enzyme, 33kDa Photosystem II, Oxygen Release Protein, 69kDa Fear ATPase Subunit, Metallothioneine Protein, Glyceraldehyde-3-Phosphate Dihydrogenase, ABA- and Mature Inducible Analogue Protein, Phenylalanine Ammonia Soluble Enzyme, Adenosine 3 Phosphate S-adenosyl-L-homocysteine hydrase, α-tubulin, cab, PEPCase, R, lectin, light harvesting complex, heat shock protein, chalcone synthase, zein, globulin-1, auxin-binding protein, UDP Glucose flavonoid glycosyl-transferase gene, MPI, oleosin, actin, opac 2, b70, oleosine and the like from a gene selected from. In certain embodiments of the invention, the identifying step consists of hybridizing DNA taken from the monocot promoter or the contiguous sequence to Coix DNA. Coix's DNA consists of a genomic DNA clone library. In another embodiment of the invention, the step of identifying the Coix promoter consists of a PCR TM . In another aspect, the present invention provides a method for preparing monocotyledonous plants according to the method described above (a); (b) provide a method of producing offspring using a method comprising the plant itself or a step of crossing the plant with a second plant. In another aspect, there is provided a method of improving a plant, which comprises: (a) obtaining plant generation of any generation of monocotyledonous plants prepared according to the methods described above; (b) characterized in that it consists of crossing with the plant itself or with the second plant. In another aspect the present invention provides a method of preparing a corn expression vector; (a) identifying a monocot promoter having a desired expression profile; (b) separating the Coix promoter homologous to the corn promoter; (c) constructs an expression vector consisting of Coix promoters linked to the selected genes. In certain embodiments of the present invention, the monocotyledonous plant can be any monocotyledonous plant, including rice, wheat, barley, rye, sugar cane and corn. In one embodiment of the invention the monocotyledonous plant is corn. In another embodiment of the invention selected genes include insect resistance genes, disease resistance genes, insecticide resistance genes, genes affecting grain composition or quality, genes using nutrients, screenable marker genes, negative selective marker genes, Encode selected properties from genes that affect the agricultural characteristics of the plant, or from environmental or stress resistant genes. In still another embodiment of the present invention, the monocot promoter is gamma agent, oleosin ole16, globulin 1, actin 1, actin c1, stroz synthase, INOPS, EMB5, globulin 2, b-32, ADPG-pyrophosphorylase , Ltp1, Ltp2, oleosin ole17, oleosin ole18, actin2, pollen specific protein, pollen specific pectase lytic enzyme, anther specific protein, anther specific gene RTS2, pollen specific gene, carpet tissue specific gene RAB24, anthranilate synthase alpha subunit, alpha zein, anthranilate synthase beta subunit, dihydrodipicolinate synthase, Thi1, alcohol dehydrogenase, cab binding protein, H3C4, RUBISCO SS starch branching enzyme, ACCase, Actin3, Actin7, Regulatory Protein GF'14-12, Ribosome Protein L9, Cellulose Biosynthetic Enzyme, S-Adenosyl-L- Homocysteine Hydrolase, Superoxide Dismutase, C-ka Naze receptors, phosphoglycerate mutases, root-specific RCc3 mRNA, glucose-6-phosphate isomerase, pyrophosphate-furactose 6-phosphate 1 phosphotransferase, ubiquinone, beta-ketoacyl- ACP synthase, 33 kDa photosystem II, oxygen releasing protein, 69 kDa hormonal ATPase subunit, metallothioneenic protein, glyceraldehyde-3-phosphate dehydrogenase, ABA- and mature inducible analogue protein, phenylalanine ammonia soluble enzyme, Adenosine triphosphate S-adenosyl-L-homocysteine hydrase, α-tubulin, cab, PEPCase, R, lectin, light harvesting complex, heat shock protein, chalcone synthase, zein, globulin-1, auxin-binding protein And UDP glucose flavonoid glycosyl-transferase genes, MPI, oleosine, actin, opac 2, b70, oleosine. In certain embodiments of the invention, the identifying step consists of hybridizing DNA taken from the monocot promoter or the contiguous sequence to Coix DNA. Coix's DNA consists of a genomic DNA clone library. In another embodiment of the invention, the step of identifying the Coix promoter consists of a PCR TM . Another aspect of the invention provides an isolated gamma coicin promoter that can be isolated from the nucleic acid sequence of SEQ ID NO: 8. The present invention also provides an isolated nucleic acid sequence consisting of about 80 to 894 consecutive nucleotides of SEQ ID NO: 8. In another embodiment of the invention, the isolated nucleic acid sequence consists of about 222 to about 894 consecutive nucleotides of SEQ ID NO: 8 or consists of a nucleic acid sequence of SEQ ID NO: 18. An isolated nucleic acid sequence consists of 412 to about 894 contiguous nucleotides of sequence SEQ ID NO: 8 or also consists of a nucleic acid sequence of SEQ ID NO: 19. Another aspect of the invention provides an isolated DNA encoding a gamma coicin protein or peptide. In another embodiment of the invention, the DNA fragment encodes a polypeptide encoded by SEQ ID NO: 16. The DNA fragment also consists of about 100 to 603 or about 350 to about 603 contiguous nucleotides of SEQ ID NO: 16. Another aspect of the invention provides an isolated gamma coicin terminator that can be isolated from the nucleic acid sequence of SEQ ID NO: 11. The coicin terminator consists of about 80 to about 412 consecutive nucleotides of SEQ ID NO: 11. In further embodiments, the terminator consists of about 200 to about 412 or about 325 to 412 consecutive nucleotides of SEQ ID NO: 11. The terminator may consist of the nucleic acid sequence of SEQ ID NO: 11. Another embodiment of the invention provides a Coix oleosin 3 terminator that can be isolated from the nucleic acid sequence of SEQ ID NO: 17. The present invention provides isolated nucleic acid sequences consisting of about 50 to about 377 or about 120 to about 377 or about 220 to about 377 or about 300 to about 377 consecutive nucleotides of SEQ ID NO: 17. to provide. In one embodiment of the invention, the nucleic acid consists of the nucleic acid sequence of SEQ ID NO: 17. Another aspect of the invention provides a modified transformed plant having a selected DNA consisting of a gamma coicin promoter. In certain embodiments of the invention, the gamma coicin promoter may be isolated from SEQ ID NO: 8. In another embodiment of the invention, the promoter comprises an isolated nucleic acid sequence consisting of about 80 to about 894, or about 222 to about 894, or about 412 to about 894 consecutive nucleotides of SEQ ID NO: 8. To provide. In another embodiment of the invention, the promoter consists of the nucleic acid sequence of SEQ ID NO: 8, SEQ ID NO: 18, SEQ ID NO: 19. Promoters can be operably linked to any exogenous gene, such as insect resistance genes, disease resistance genes, insecticide resistance genes, genes affecting grain composition or quality, genes using nutrients, screenable marker genes, Negative selectable marker genes, genes affecting the agronomic characteristics of the plant, and environmental or stress resistant genes. In another aspect of the invention there is provided a modified transformed plant having selected DNA consisting of a gamma coicin promoter. In certain embodiments of the invention, the gene encoding a gamma coicin protein or peptide encodes a polypeptide encoded by SEQ ID NO: 16. The gene encoding gamma coicin consists of about 100 to 603 or about 350 to about 603 contiguous nucleotides of SEQ ID NO: 16. In a further embodiment of the invention, the gene encoding gamma coicin consists of the nucleic acid sequence of SEQ ID NO: 16. In another aspect of the invention there is provided a modified transformed plant consisting of selected DNA consisting of gamma coicin terminator. In an embodiment of the invention, the gamma coicin terminator may be isolated at SEQ ID NO: 11. In another embodiment of the present invention, the gamma coicin terminator is from about 80 to about 412 contiguous nucleotides of SEQ ID NO: 11 or from about 200 to about 412 or about 325 to 412 contiguous nucleotides It is composed. In another embodiment of the invention, the gamma coicin terminator may consist of the nucleic acid sequence of SEQ ID NO: 11. Another aspect of the invention provides a modified transformed plant composed of selected DNA consisting of Coix oleosin 3 terminator. In another embodiment of the present invention Coix oleosin 3 terminator can be isolated in SEQ ID NO: 17. In another embodiment of the invention, the terminator is about 50 to about 377 or about 120 to about 377 or about 220 to about 377 or about 300 to about 377 sequences of SEQ ID NO: 17 Is composed of nucleotides. In one embodiment of the invention, the terminator consists of the nucleic acid sequence of SEQ ID NO: 17. In another aspect of the invention, there is provided a descendant plant of any generation of any of the plants described above, wherein the plant consists of the selected DNA. In certain embodiments of the invention, the plant is a monocotyledonous plant selected from rice, wheat, barley, sugar cane, corn. In another embodiment of the invention, the plant is a dicotyledonous plant selected from tobacco, tomatoes, potatoes, beans and cotton. In still another aspect of the present invention, there is provided a method of breeding a plant by crossing the modified transformed plant of the present invention or its transformed descendants or other second plants capable of inheriting exogenous DNA of the present invention. do. 1. Field of Invention The present invention relates generally to transformed plants. More specifically, the present invention relates to methods and compositions thereof for expressing a transgene in a plant. The following drawings are part of the present application to illustrate certain aspects of the present invention. The invention will be better understood with reference to the description of the specific embodiments presented herein and these figures. 1 is a map of plasmid pDPG844. The plasmid is an expression cassette consisting of the 894 bp promoter (SEQ ID NO: 8) of the gamma coicin gene, the coding sequence of the GUS reporter gene, and the nos terminator. 2 is a map of plasmid pDPG845. The plasmid is an expression cassette consisting of the 894 bp promoter (SEQ ID NO: 8) of the gamma coicin gene, the coding sequence of the GUS reporter gene, and the nos terminator. 3 is a map of plasmid pDPG846. The plasmid is an expression cassette consisting of the 412 bp promoter (SEQ ID NO: 19) of the gamma coicin gene, the coding sequence of the GUS reporter gene, and the nos terminator. 4 is a map of plasmid pDPG847. The plasmid is an expression cassette consisting of the 412 bp promoter (SEQ ID NO: 19) of the gamma coicin gene, the coding sequence of the GUS reporter gene, and the nos terminator. 5 is a map of plasmid pDPG848. The plasmid is an expression cassette consisting of a 222 bp promoter (SEQ ID NO: 18) of the gamma coicin gene, a coding sequence of the GUS reporter gene, and a nos terminator. 6 is a map of plasmid pDPG849. The plasmid is an expression cassette consisting of a 222 bp promoter (SEQ ID NO: 18) of the gamma coicin gene, a coding sequence of the GUS reporter gene, and a nos terminator. 7 is a map of plasmid pDPG869. The plasmid contains 894bp promoter (SEQ ID NO: 8) taken from the gamma coicin gene, actinal intronol of rice, coding sequence of the gamma coicin gene (SEQ ID NO: 16), and gamma coicin terminator (SEQ ID NO: 11). Figure 8 compares the sequences of the promoter portion of gamma-proramine encoding the genes of corn, sugar cane and Coix. The same nucleotides are shown in bold in the three sequences. Corn, Coix, sugarcane promoter sequences include gamma zein (SEQ ID NO: 23), gamma coicin (SEQ ID NO: 8); Gamma capiline (SEQ ID NO: 22), respectively. 9 is a map of plasmid pDPG851. The plasmid consists of an 894bp promoter (SEQ ID NO: 8) taken from the gamma coicin gene, actinal intronol of rice, a coding sequence of the gamma coicin gene (SEQ ID NO: 16), and a nos terminator. 10 is a map of plasmid pDPG862. The plasmid consists of an 894bp promoter (SEQ ID NO: 8) taken from the gamma coicin gene, actinal intronol of rice, a coding sequence of the gamma coicin gene (SEQ ID NO: 16), and a nos terminator. 11 is a map of plasmid pDV108. Remedies include gamma coicin terminator (SEQ ID NO: 11). The present invention overcomes the shortcomings of the prior art by providing a method for expressing a transgenic gene that eliminates or reduces gene silencing. The present invention provides a promoter for expressing exogenous genes in monocotyledons with an expression profile similar to that of the host genome while having sufficient differences to limit gene silencing. In certain embodiments of the invention, the promoter provided by the invention is obtained from Coix. Promoters derived from Coix are useful not only in corn but also in other monocotyledonous and dicotyledonous plants such as wheat, rice, barley, rye and sugar cane. Gene silencing, also known as co-inhibition, sense suppression, and sense co-inhibition, reduces or eliminates gene expression when introducing sequences with inherent homologous copies (Napoli et al., 1990; Van der Krol). et al., 1990). Gene silencing acts in the regulatory or coding portion of the foreign transgene, and is often associated with methylation of the silent portion. In the field of agricultural biotechnology, silencing of regulatory regions is particularly problematic when many endogenous promoters have properties that are particularly useful for the expression of foreign transgenes. The inventors believe that the utility of the present invention leads to the production of expression vectors consisting of elements of Coix in addition to the promoter. In particular, gene silencing and other problems associated with homology between the foreign gene element and the native sequence can be avoided by using Coix for the foreign genes expressed in the monocots other than Coix. For example, the coding portion homologous to the maize gene is effectively expressed in maize, while the native maize gene is silent. It is believed from Coix that enhancer elements and terminators are particularly useful. 1. Promoter to be used in the present invention The present invention includes the use of a promoter of the genus Coix to express exogenous genes in monocots such as corn. Such promoters can be separated from Coix de novo or based on genetic information of known monocot promoters. An effective method that the inventors believe to be particularly useful for identifying Coix promoters is to isolate homologous sequences in Coix using primers or probes derived from corn genes or promoters. (i) Example of promoter Useful promoters include Poszkowski et al., 1989; Inducible, viral, synergistic, constitutive promoters as described in Odell et al., 1985, and transiently regulated, spatially regulated, and space-temporally regulated promoters (Chau et al., 1989). do. Promoters are selected for their ability to direct the transcriptional activity of transformed plant cells or transformed plants to the coding portion. Some examples of maize sequences that are considered particularly useful for isolating Coix promoters include Adh (Walker et al., 1987; Paul and Ferl, 1991; Genbank Accession No. S45022); Sucrose synthase (Yang & Russell, 1990); cab (Sullivan et al., 1989, Genbank Accession No. X14794); PEPCase (Hudspeth & Grula, 1989; Yanagisawa and Izui, 1989, Genbank Accession Nos. X14579, X14581, X14580); R gene complex related genes (Chandler et al., 1989; Consonni et al., 1993, Genbank Accession No. X67619; Radicella et al., 1991, Genbank Accession Nos. X57276, S48027). Other monocots such as the sequence of the rice actin promoter (Genbank Accession No. S44221) may be useful. Examples of genes for isolating tissue-specific promoters include grain sucrose synthase I (Yang et al., 1990); Grain alcohol dehydrogenase I (Vogel et al., 1989; Dennis et al., 1984, Genbank Accession Nos. X04049, X00581); Grain light harvesting complexes (Simpson, 1986; Bansal et al., 1992, Genbank Accession No. M87020); Grain heat shock protein (Odell et al., 1985; Rochester et al., 1986, Genbank Accession No. X03714); Corn Jane (Reina et al., 1990, Genbank Accession No. X53514; Kriz et al., 1987, Genbank Accession No. X05911; Wandelt and Feix, 1989; Genbank Accession No. X14334; Langridge and Feix, 1983, Genbank Accession No K00543, Reina et al., 1990, Genbank Accession No. X53515); Globulin-I (Belanger and Kriz et al., 1991; Genbank Accession Nos. L22344, S22295); Chalcone synthase gene (Franken et al., 1991; Genbank Accession No. X60204). Other similar known maize sequences include root cell promoters (Conkling et al., 1990) and tissue specific hens (Fromm et al., 1989). Examples of inducible promoters include ABA- and swelling inducible promoters and promoters of auxin-binding protein genes (Scwob et al., 1993; Genbank Accession No. L08425). Other known maize sequences that can be used to isolate heterologous promoters include the UDP glucose flavonoid grillosyl-transferase gene (Ralston et al., 1988; Genbank Accession Nos. X07940; Y00616); MPI proteases inhibitor gene (Cordero). et al., 1994; Genbank Accession No. X78988); Glyceraldehyde-3-phosphate dehydrogenase gene (Genbank Accession No. U45859; Kohler et al., 1995, Genbank Accession No. L40803; Quigley et al., 1989, Genbank Accession No. X15408; Martinez et al., 1989, Genbank Accession No. X15596) and chloroplast gene promoters (Genbank Accession No. X86563) and the like. Table 1 below lists the gene elements considered in the present invention for separating Coix sequences for expression in corn and other monocots. These various elements can be used to prepare expression vectors as indicated below. Table 1a Table 1b a. Pointed promoter is used for maize transformation b. Intelligent intron enhancements use corn transformation c. Separation of Coix Promoter for Transformation of Corn d. Coix protein coding sequence (CDS) is isolated and used for maize transformation (ii) Cloning of Homologous Sequences from Coix Part of the invention relates to the separation of regulatory moieties from the genus Coix using probes or primers derived from corn genes or their contiguous parts. Probes or primers can consist of cloned corn DNA or can be synthesized based on DNA sequence data. Alternatively, promoters can be isolated using sequences derived from species other than maize, corn and species in close proximity to Coix. Other species that appear useful in identifying heterologous promoters in Coix include rye, wheat, barley, oats, sugar cane, and monocotyledonous plants such as rice. Promoters as defined herein include any nucleic acid capable of priming initial nucleic acid synthesis in a template-dependent process. Generally, primers are oligonucleotides of 10 to 20 base pairs in length, but longer sequences can be used. The primer may be double stranded or single stranded, but single stranded is more appropriate. Probes can act as primers, but are defined differently. Although priming is possible, probes are designed to bind to target DNA or RNA and need not be used in the amplification process. In suitable embodiments, the primer or probe may comprise enteroactive species ( 32 P, 14 C, 35 S, 3 H); Fluorescent materials (rhodamine, flororesine); Antigens (biotin, streptoavidine, digoxigenin); Label it with a chemiluminescent substance (luciferase), etc. or conjugate it directly to an enzyme (alkaline phosphatase). After preparing the probe or primer, the first step to clone the heterologous promoter is to prepare and screen the appropriate clone library, which in this case is Coix's genomic DNA library. Screening is based on hybridization of oligonucleotide probes designed from corn promoter sequences or DNA sequences of genes or related genes. Such screening prototols are known to those skilled in the art and are described in detail in Sambrook et al. (1989). 1. Template dependency amplification Template-dependent amplification methods For example, PCR is at an effective level of separating other sequences from maize-homology or Coix. In particular, primers are designed based on genetic information of homologous sequences, which can be used to template dependent amplify nucleic acid sequences consisting of Coix promoters. Various template dependency processes can be used to amplify the sequences present in a given template sample. One of the best known methods of amplification is polymerase chain reaction (called PCR TM ), which is described in US Pat. No. 4,683,195; 4,683,202; 4,800,159. In brief, the two primer sequences in the PCR TM make two primer sequences complementary to the part in the opposite complementary strand of the marker sequence. Excess deoxynucleoside triphosphate is added to the reaction mixture with a DNA polymerase such as Taq polymerase. If there is a label sequence in the sample, the primer binds to the label and the polymerase extends along the label sequence with the addition of nucleotides by the polymerase. By controlling the temperature of the reaction mixture, the extended primer is dissociated from the label to produce the reaction product, the excess primer binds to the label and the reaction product and the process is repeated. Reverse transcriptase PCRTM amplification procedures can be performed to quantify the amount of mRNA amplified. Methods for reverse transcription of RNA into cDNA are known and described in Sambrook et al. (1989). Another method for reverse transcription is to use a thermally stable RNA-dependent DNA polymerase. Such a method is described in PCT / WO90 / 07641, filed in 1990. Polymerase chain reaction methods are also known in the art. Another method for amplification is the league chain reaction (“LCR”), which is described in EP 0 320 308. In LCR, two complementary probe pairs are prepared and bound to opposite complementary strands of the target that each pair encounters in the presence of the target sequence. In the presence of ligase, two probe pairs are joined to form a single unit. The temperature is exchanged, such as PCR ™ , to allow the bound ligation units to dissociate from the target, which acts as a “target sequence” for ligation of excess probe pairs. US Pat. No. 4,883,750 describes a method similar to LCR for binding probe pairs to target sequences. Another amplification method of the present invention may use Qbeta Replicase (described in PCT / US87 / 00880). In this method, a replication sequence of RNA having a portion complementary to the target was added to the sample in the presence of RNA polymerase. The polymerase copies the replication sequence to be detected. An isothermal amplification method (which uses endonucleases and ligands to amplify a target molecule comprising nucleotide 5 ′-[α-thio] -triphosphate at one strand of restriction enzyme site) is used to amplify the nucleic acid of the present invention. Available (Walker et al., 1992). Strand substitution amplification (SDA) is another method of performing isothermal amplification of nucleic acids such as agitation and nick translation, which involves multiple strand substitutions and synthesis. A similar method, also called Repair Chin Reation (RCR), anneals several probes in the target region for amplification and performs a repair reaction in which only two of the four bases are present. The other two bases are added in biotinylated derivative form for easy sensing. Similar methods are used for SDA. Cyclic probe reaction (CPR) can be used to detect target specific sequences. In CPR, probes having 3 'and 5' sequences of non-specific DNA and having intermediate sequences of specific RNA are hybridized to the DNA in the sample. In the hybrid reaction the reaction is treated with RNase H and the probe product is identified as a separate product which is released to the cleavage. The native template is annealed to another cycling probe and the reaction is repeated. Another amplification method described in GB 2 202 328 and PCT / US89 / 01025 can be used in the present invention. In the former case, “modified” primers are used for PCR TM -type dependent, template-dependent, enzyme-dependent synthesis. Primers are modified by labeling with a capture moiety (eg biotin) or a detection moiety (enzyme). In the latter case, an excess of labeled probe is added to the sample. In the presence of the target sequence, the probes bind and are catalytically cleaved. After cleavage, the target sequence is released in native form bound by excess probes. The labeled probe is cleaved to indicate the presence of the target sequence. Other nucleic acid amplification processes include transcriptional amplification systems (TAS), including nucleic acid sequence amplification (NASBA) and 3SR (Kwoh et al., 1989; Gingeras et al., PCT / WO88 / 10315). In NASBA, nucleic acids can be prepared by standard phenol / chloroform extraction, thermal denaturation of clinical samples, treatment with lysis buffer, minispin columns for separation of DNA and RNA, guanidinium chloride extraction of RNA. This amplification technique is to anneal to primers having a target specific sequence. After polymerization, the DNA / RNA hybrid is cleaved with RNaseH and the double stranded DNA molecule is again thermally denatured. In either case, the single stranded DNA is completely double stranded by the addition and polymerization of the second target primer. Double stranded DNA molecules are then multiplexed by RNA polymerases such as T7 and SP6. In an isothermal cycle reaction, RNA's are reverse transcribed into single stranded DNA, which in turn is converted to double stranded DNA and then transcribed again with an RNA polymerase such as T7 or SP6. The resulting product, whether truncated or fully formed, is a target specific sequence. EP 0 329 822 describes the process of nucleic acid amplification, which periodically synthesizes single stranded RNA (“ssRNA”), ssDNA, and double stranded DNA (dsDNA) and can be used in the present invention. ssRNA is a template of the first primer oligonucleotide, which is extended by reverse transcriptase (RNA-dependent DNA polymerase). RNA is then removed from the resulting DNA: RNA double helix using ribonuclease H (RNase H, RNase specific for RNA doubled with DNA or RNA). The resulting ssDNA is a template of a second primer, which includes an RNA polymerase promoter (T7 RNA polymerase) sequence. Such primers are extended with DNA polymerases (eg, "Klenow" fragments of E. coli DNA polymerase I) to create double stranded DNA ("dsDNA") molecules, which are native RNAs between the primers. Same as the sequence of, the promoter sequence was added at the end. Using such promoter sequences with appropriate RNA polymerase, many RNA copies of DNA can be made. This copy can then be cycled and induce very fast amplification. If the appropriate enzyme is selected, this amplification can be carried out isothermally without the addition of enzyme in each cycle. Because of the cycle nature of this process, the starting sequence should be selected in DNA or RNA form. PCT / WO89 / 06700 describes nucleic acid sequence amplification processes that hybridize promoter / primer sequences to target single-stranded DNA (“ssDNA”) and transcribe many RNA copies of the sequence. This process is not periodic, i.e. no new template is made from the RNA transcript produced. Other amplification methods include "RACE" and "one-sided PCR ™ " (Frohman, 1990; Ohara et al., 1989) and the like. Methods based on two or more oligonucleotide ligations with the resulting di-oligonucleotide sequences and thus in the presence of nucleic acids that amplify the di-oligonucleotides can be used in the amplification step of the present invention (Wu et al., 1989). . After amplification, in one or another step, it is desirable to separate the amplification product and excess primers from the template to determine if a particular amplification has occurred. In one embodiment, the amplification products can be separated by agarose, agarose-acrylamide or polyacrylamide gel electrophoresis using standard methods (Sambrook et al., 1989). Alternatively, chromatographic methods can be used to effectively separate. There are many chromatographic methods available for use in the present invention, including adsorption; These can be highly specialized, including separation, ion-exchange, molecular filtration and column, paper, thin layer, gas chromatography, etc. (Freifelder, 1982). The product is visually confirmed to confirm amplification of the marker sequence. In general, the method of identification can be seen in UV light by coloring with ethidium bromide. EH can be seen under an appropriate stimulus spectrum after exposing or amplifying the amplification product to X-ray film when the amplification product is labeled with radioactive or fluorescently labeled nucleotides. In one embodiment, visual confirmation may be indirect. After separation of the amplification product, the labeled nucleic acid probe is contacted with the amplified label sequence. The probe is conjugated with the chromosome but can be radiolabeled. In another embodiment, the probe is conjugated to a binding partner, such as an antibody or biotin, and other members of the binding pair have a detectable moiety. In another embodiment the sensing is by a labeled probe. Related techniques are well known in the art and can be found in the molecular biology book (Sambrook et al., 1989). For example, targets can be identified during or after amplification with chromophore or radiolabeled probes or primers. One example of the foregoing is U.S. Patent No. 5,279,721 describes automated electrophoretic devices and methods and methods for delivering nucleic acids. The device can be electrophoresed and subjected to blotting to carry out the method according to the invention. In addition, the amplification products described above are subjected to sequencing to identify various kinds of variables using target sequencing techniques. In certain methods, sequencing is performed using primer sets designed for optimal sequencing (Pignon et al., 1994). The present invention provides a method that can utilize any analysis or all forms of analysis. 2. Southern / Northern Blotting Blotting techniques can be used in other methods known in the art to identify nucleic acids for use in the present invention. For example, Southern blotting can be used to isolate DNA fragments containing the Coix promoter, which is a recommendation useful for expressing corn genes. In particular, maize cDNA probes can be hybridized to genomic DNA clones of Coix plants to isolate clones comprising the promoter portion of the corresponding gene. Alternatively, the homologous Coix promoter can be directly identified using the promoter itself sequence as a probe. Southern blotting uses DNA as a target, while northern blotting uses RNA as a target. Each provides different information, but cDNA blotting is similar in many ways to blotting or RNA species. Briefly, probes are used to target DNA or RNA species immobilized on a suitable matrix, ie a natyrcellulose filter. Different species are analyzed in spatial separation. This is done by gel electrophoresis of nucleic acid and "blotting" on a filter. Subsequently, the blotted target is incubated with a probe (typically labeled) under conditions that promote denaturation and rehybridization reactions. Since the probe is intended to base pair with the target, the probe will bind to a portion of the target under renatured conditions. The unbound probe is removed and detection as described above is performed. 3. Chip Technology The present invention describes a chip based DNA technology such as described in Hacia et al. (1996) and Shoemaker et al. (1996). In short, this technique is a quantitative way to quickly and accurately analyze a large number of genes. Using a probe sequence immobilized on a gene or tagging with oligonucleotides, using chip technology to isolate target molecules in high density arrays and screening such molecules based on hybrid reactions (Pease et al., 1994; Fodor et al., 1991). (iii) De novo Coix promoter isolation The present invention utilizes isolated Coix promoters without using probes or primers derived from other species of promoters. Means for cloning promoters and their constructs into appropriate vectors to express transformed and exogenous genes in maize are known to those of skill in the art and are well described in Sambrook et al., 1989. Coix promoter types, which are considered particularly useful for exogenous gene expression in maize, are those that are expressed at high levels in a constitutive or non-constitutive manner. Preferred non-constitutive promoters are those that are expressed in a tissue or that are expressed in a transiently specific manner, ie inducible promoters. Temporal specificity refers to a promoter that directs expression in one or more specific developmental periods. The general first step to cloning a promoter is to identify target genes that are expressed in a desired manner, ie constitutively or in tissue / temporal specificity. An effective way to do this is to prepare a cDNA library from one or more identified target tissues and identify many replication clones therein. Particularly beneficial is the fact that cDNA clones are provided directly, while the number of gene copies is small. The cDNA clones are then used to isolate genomic DNA consisting of 5 ′ partial contiguous coding sequences comprising a promoter portion using standard library screening techniques known to those skilled in the art (see Sambrook et al., 1989). A suitable way to clone a promoter is to use "inhibition PCR" as described in Siebert et al., 1995. This method can PCR amplify uncloned and unknown sequences if they know gene specific fixed sequences. Using such sequences, known sequences, such as homologous or homologous cDNA sequences, are used to clone regulatory elements on the side including the promoter, enhancer, and terminator. 1. Quantification of gene expression by relative quantitative RT-PCR TM Relative quantification PCR ™ (RT-PCR ™ ) is performed after reverse transcription (RT) from RNA to cDNA to RNA to determine the relative concentration of specific mRNA isolated from plants. To determine the concentration change of a particular mRNA species, it can be seen that the gene encoding the particular mRNA species is differentially expressed. In this manner, recommended promoters from Coix are quickly identified and screened for use in constructing expression vectors for corn transformation. In PCR ™ , the number of target DNA molecules amplified is increased by a factor approaching 2 in every cycle of the reaction until some reagent is limited. Then, until there is no increase in the amplified target in the main period, the amplification rate is gradually reduced. In the case of plotting a graph in which the concentration of the target DNA amplified by the number of cycles on the Y axis is plotted, a characteristic curve is formed by connecting the plotted points to each other. When the first cycle begins, the slope is positive and constant. This refers to the linear part of the curve. After limiting the reagents, the slope of the line is reduced to eventually zero. The concentration of target DNA amplified at this point becomes an asymptotic curve at a fixed value. That is, the plateau portion of the curve. The concentration of target DNA in the linear portion of PCR TM amplification is linearly proportional to the starting concentration of the target before the reaction begins. By completing the same number of cycles and determining the concentration of the amplified product of the target DNA in the PCR TM reaction in the linear portion, it is possible to determine the relative concentration of a particular target sequence in the native DNA mixture. If the DNA mixture is cDNA synthesized from RNA isolated from different tissues or cells, the relative abundance of the particular mRNA from which the target sequence was derived may be determined for each tissue or cell. The direct proportion between the concentration of the PCR ™ product and the relative mRNA abundance is only for the linear portion of the PCR ™ reaction. The final concentration of the target DNA in the plateau portion of the curve is determined by the availability of the reagents in the reaction mixture, which is independent of the original concentration of the target DNA. Thus, the first condition that is encountered before RT-PCR ™ is determined by RT-PCR ™ to collect the RNA population is that the first condition encountered is the concentration of amplified PCR ™ product when the PCR ™ reaction is in the linear portion of the curve. Is to sample. In order to successfully determine the relative abundance of a particular mRNA species, a second condition in the RT-PCR ™ study is that the relative concentrations of amplifiable cDNAs must be standardized against some independent criteria. The purpose of the RT-PCR ™ study is to determine the abundance of a particular mRNA species relative to the average abundance of all mRNA species in the sample. Most protocols for competing PCR ™ utilize internal PCR ™ standards, which are present in amounts approximately similar to the target. This strategy is effective to sample the product of PCR TM amplification during the linear phase. If the product is sampled at the time the reaction approaches the stagnation phase, a relatively small number of products are overexpressed. When comparing the relative amounts made on a number of different RNA samples, such as when testing RNA samples for differentiation, the results of this comparison are distorted in a direction where the difference in relative amounts of RNA is less than actual. This is not a problem if the amount of internal reference is much greater than the target. If the amount of internal reference is much greater than the target, a comparison of shunts can be made between RNA samples. In the above, the theoretical analysis of the RT-PCR TM analysis of plant tissues has been described. A problem inherent in plant tissue samples is that their amount changes (problems for standardization) and their properties change (reliable internal standards, preferably with the need for secondary expression of larger internal targets than targets). These problems RT-PCR Quantitative RT-PCR relative to the TM TM held by the internal standard The internal standard is larger than the target cDNA fragment, and the amount of mRNA encoding the internal standard is approximately 5-100 times more than the amount of mRNA encoding the target. This analysis measures relative amounts, not absolute amounts, of individual mRNA types. Other studies can be conducted using the more general relative quantitative RT-PCR ™ assay with an external reference protocol. In these assays, PCR ™ products are sampled in the linear region of the amplification curve. The optimal number of PCR TM cycles for sampling should be determined empirically for each target cDNA fragment. In addition, the reverse transcriptase products of each RNA population isolated from various tissue samples should be carefully standardized for each concentration of amplifiable cDNA. This consideration is particularly important because it measures absolute mRNA levels in these assays. Absolute mRNA amounts can be used as values of differentiation gene expression only in standardized samples. Standardization of the linear range of empirically determined and cDNA population of the amplification curve is the result of doegin consumption boring a long time but, RT-PCR TM analysis may be superior to the results derived from the relative quantitative RT-PCR TM analysis held by the internal standard . One reason for this advantage is that in the absence of internal standards / competitors all reagents are converted to a single PCR TM product in the linear range of the amplification curve, thus increasing the sensitivity of the assay. Another reason is that with one PCR TM product, the display or other display method of the product in the electrophoretic gel becomes less complex and the background is less easy to interpret. 2. Non-Targeted Promoter Isolation In addition to cloning the promoter in a specific targeted manner to identify genes with the desired expression profile, Coix promoters can be cloned using a "shotgun" selection strategy. For example, multiple vectors can be made that contain selectable or selectable mark genes linked to any segment of Coix DNA. Such a vector can be made by mixing and ligation of a portion of the restriction truncated mark gene DNA with Coix whole genomic DNA and cloning the DNA into the appropriate vector. Alternatively, a "headless horseman" construct can be used, where the cloning position is located immediately before the mark gene lacking a promoter. In this case, the mark gene will be expressed only if the promoter is cloned at the cloning site. Once constructed, these vectors can be used to transform multiple corn cells. Transformants expressing the mark gene are harvested to identify novel Coix promoters capable of directing expression in maize. (iv) analysis of promoters The composition or utility of the promoter once cloned can be confirmed by sequencing or expression analysis. For plants, expression analysis consists of a system using germ cells or non-germ cells, or alternatively whole plants. The advantage of using cytometry is that no reproduction of many plants is required, but the system is limited in that promoter activity on non-reproduced cells may not directly correlate with expression in plants. The biosample to be analyzed consists of nucleic acids isolated from cells of any plant material according to standard methods (Sambrook et al., 1989). The nucleic acid is genomic DNA, or aliquoted or whole cell RNA. If total RNA is used, it is preferred to convert the RNA to complementary DNA. In one embodiment, the RNA is whole cell RNA, and in another embodiment, the RNA is poly-A RNA. In general, nucleic acids are amplified. Depending on the form, the particular nucleic acid of interest is identified in the sample either directly using amplification or as a second known nucleic acid after amplification. Next, the identified product is detected. In certain instances, detection may be by visual means (eg, ethidium bromide staining of the gel). Other detection methods include fluorescence, radiolabels or radioscopy of fluorescent labels, or indirect identification of products through systems using electrical or thermal shock signals (Affymax Technology; Bellus, 1994). After detection, the results observed in any plant are compared with the statistical significance group of the non-transformed control plants. In general, non-transformed control plants have a similar genetic background to the transformed plants. In this way, differences in the amount and type of protein detected in various transformed plants can be detected. Alternatively, clone cultures of cells, eg, fusion cells or immature embryos, are compared with other cell samples. As indicated, a number of different assays can be considered for the selection of promoters associated with the cells or plants of the present invention. These techniques can be used to detect the presence and expression of cellular genes and rearrangements that occur on gene constructs. These techniques include fluorescence in situ hybridization (FISH), direct DNA sequencing, pulsed field gel electrophoresis (PFGE) analysis, sudden or nozan blotting, single-stranded transformation analysis (SSCA), RNAse protection analysis, allele- Specific oligonucleotides (ASOs), dot blot analysis, denaturation gradient gel electrophoresis, RFLP, PCR TM- SSCP, but are not limited to these. When a clone comprising a promoter is separated according to the present invention, it is conceivable to delimit the essential promoter region within the clone. An effective way to do this is a fruit. In deletion assays, a series of constructs are created, each having a different region of the clone (subclone), after which each construct is selected for promoter activity. A suitable method of screening for activity is to attach the deleted promoter construct to a selectable or selectable mark and to isolate cells expressing the mark gene. In this way, a number of different deletion promoter constructs that retain promoter activity can be identified. II How to Make a Mutated Promoter The inventors thought that by mutating the Coix promoter, the utility of the promoter for the expression of foreign transgenes in maize could be significantly improved. Mutagenesis of the Coix promoter may be performed at random, and the mutated promoter may be useful for screening during trial and error. Alternatively, specific sequences can be identified that provide Coix promoters with the desired expression properties, and these or similar sequences can be introduced into the corn promoter via mutation. In addition to corn, promoters from other species can be mutated to provide promoters with the beneficial properties of the Coix promoter. For example, a promoter obtained from rice, oats, sugar cane, barley or wheat can be mutated to provide a mutated promoter with enhanced utility for enhanced transgene expression in maize. Methods for mutating DNA segments encoding promoters of the invention are known to those skilled in the art. Modifications to these promoter regions can be effected randomly or by specific-site mutagenesis. The promoter region may modify the structure through the addition or deletion of one or a plurality of nucleotides of the sequence encoding the corresponding non-modified promoter region. Mutagenesis may be carried out in one of the techniques known in the art, including but not limited to the synthesis of oligonucleotides carrying one or more mutations in the sequence of a particular promoter region. In particular, site mutagenesis is a useful technique for the production of promoter variants through specific mutations of the underlying DNA. This technique also provides the ability to create and test sequence variants by introducing one or a plurality of nucleic acid sequence changes into the DNA. Site mutagenesis allows for the production of variants using specific oligonucleotides encoding the DNA sequence of the desired mutation and multiple adjacent nucleotides, thereby forming stable double helices on both sides of the crossing deletion junctions. Provide primer sequences with sufficient size and sequence complexity. Generally, primers consisting of 17 to 75 or more nucleotides are suitable, with 10 to 25 or more residues located on either side of the junction of the sequence being modified. In general, specific site mutagenesis techniques are known in the art and are exemplified in various publications. As will be appreciated, this technique generally employs a fizzy vector that is either single stranded or double stranded. Typical vectors useful for specific site mutagenesis include vectors such as M13 phage. These phages are commercially available and their use is known to those skilled in the art. Double stranded plasmids are also used for mutagenesis at specific sites, which eliminate the need for transferring the gene of interest from the plasmid to phage. In general, site mutagenesis in this article is performed either by first obtaining a single stranded vector or by separating the double strand of a double stranded vector carrying a DNA sequence encoding a desired promoter region or peptide in the sequence. Oligonucleotide primers having the desired mutated sequence are generally made synthetically. This primer is then annealed to a single-stranded vector and subjected to E. coli polymerase I Klenow fragment DNA polymerase to complete the synthesis of the mutant-bearing strand. Thus, a heterologous double helix is formed when one strand encodes the original non-mutated sequence and the second strand carries the desired mutation. This heteroduplex vector is then used to transform or transfect appropriate cells, such as corn cells, and to select cells containing the recombinant vector with the mutated sequence. The gene selection scheme was devised by Kunkel et al. (1987) to increase the amount of clones incorporating mutant oligonucleotides. Alternatively, PCR TM using a commercially available thermostable enzyme (eg, Taq polymerase) incorporates the mutant oligonucleotide primers into the amplified DNA fragment, which is then cloned into an appropriate cloning or expression vector. Can be. PCR ™ -mediated mutagenesis processes (Tomic et al. (1990), Upender et al. (1995)) provide two examples of this protocol. In addition to thermostable polymerase, PCR ™ using thermostable ligase is used to incorporate phosphorylated mutant oligonucleotides into amplified DNA fragments, which are then cloned into appropriate cloning or expression vectors. The mutagenesis process proposed by Michael (1994) is an example of such a protocol. Sequence variant production of selected promoter-encoded DNA segments using specific site-mutagenic induction suggests, but is not limited to, means of producing potentially useful species, for example, to obtain sequence variants of DNA sequences. There is another way to do it. For example, a recombinant vector encoding a desired promoter sequence can be treated with a mutant agent, such as hydroxyamine, to obtain sequence variants. In this article, "oligonucleotide-driven mutagenesis process" refers to template-dependent processes and vector-mediated proliferation, which results in an increase in the concentration of a particular nucleic acid molecule relative to its initial concentration, or detection such as amplification. The concentration of possible signals increases. As used herein, "oligonucleotide-driven mutagenesis process" also refers to a process involving template-dependent expansion of primer molecules. Template-dependent processes refer to the synthesis of nucleic acids of RNA or DNA molecules, where the sequence of the newly synthesized nucleic acid strands conforms to known complementary base pair rules (Watson and Ramstad, 1987). In general, vector mediated methods include the introduction of nucleic acid fragments into a DNA or RNA vector, unicellular amplification of the vector, and collection of the amplified nucleic acid fragments. An example of this approach is U.S. Patent No. 4,237,224, which is incorporated herein by reference. A number of template dependent procedures can be used to amplify the target sequence of interest present in the sample, which is known in the art and described in detail below. III transformation There are many ways to transform DNA segments into cells, but not all methods are suitable for delivering DNA to plant cells. Methods that can be used in the present invention include almost all methods for introducing DNA into cells, examples of which include direct delivery of DNA by PEG-mediated transformation of prokaryotes (Omirulleh et al., 1993), dry / inhibited-mediated DNA inhalation (Potrykus et al., 1985), electroporation (US Patent No. 5,384,253), agitation using silicon carbide fibers (Kaeppler et al., 1990; US Patent No. 5,302,523) US Patent No. 5,464,765; Agrobacterium-mediated transformation (US Patent No. 5,591,616; US Patent No. 5,563,055); Acceleration of DNA coated particles (US Patent No. 5,550,318; US Patent No. 5,538,877; US Patent No. 5,538,880. Through the application of this technique, corn and practically all plant species are stably transformed, and these cells grow into transgenic plants. , The acceleration method is preferred, Flags include microprojection drops. (i) Electroporation When DNA is to be introduced by electroporation, a method such as Krzyzek (U.S. Patent No. 5,384,253) is considered to be particularly preferable. In this method, specific cell wall-degrading enzymes, such as pectin-degrading enzymes, are used to make target recipient cells more sensitive to transformation than untreated cells. Alternatively, the recipient cells are made mechanically wound and susceptible to transformation. In order to effect transformation by electroporation, soft tissues such as suspensions of cells or embryonic fusion cells are used, or direct transformation of immature or other organized tissues is carried out. In this technique, the cell wall of a selected cell is exposed to pecton-degrading enzymes (fectorylase) or the part of the cell wall is degraded by mechanical wounds in a controlled manner. Examples of species transformed by electroporation of intact cells include corn (US Patent No. 5,384,253; D'Halluin et al., 1992; Rhodes et al., 1995), wheat (Zhou et al., 1993). ), Tomatoes (Hou and Lin, 1996), soybeans (Christou et al., 1987), tobacco (Lee et al., 1989). Prokaryotes can also be used for plant electroporation transformation (Bates, 1994; Lazzeri, 1995). For example, the generation of transgenic soybean plants by electroporation of cotyledon-derived protoplasts is presented by Dhir and Widholm (Intl. Patent Appl. Publ. No. WO 9217598). Examples of other species for which protoplast transformation is described include barley (Lazerri, 1995), oats (Battraw et al., 1991), corn (Bhattacharjee et al., 1997), wheat (He et al., 1994), tomatoes (Tsukada, 1989) and soybeans (Dhir et al., 1992). (ii) dropping microprojectiles Suitable methods for delivering transformed DNA segments to plant cells in accordance with the present invention are microprojection projections (U.S. Patent No. 5,550,318; U.S. Patent No. 5,538,880; U.S. Patent No. 5,610,042; PCT Application WO 94/09699). In this method, the particles are coated with nucleic acid and delivered to the cell with propulsion. Examples of particles are particles consisting of tungsten, planinium, and gold. In some cases, DNA precipitation into metal particles is unnecessary for the recipient cell delivery of DNA using microprojection projection. However, one can think of the particles as containing DNA rather than being coated with DNA. Therefore, we propose a method of increasing the level of DNA delivery through particle release rather than the DNA-coated particles themselves. An embodiment of a method of delivering DNA to maize cells by acceleration is a Biolistics Particle Delivery System, which propels particles coated with DNA or cells to pass through a network (eg, a stainless or Nytex network). After that, it can be used to deliver DNA or cells to the filter surface covered with monocotyledonous plant cells cultured in suspension. The network disperses the particles and prevents them from being delivered to the recipient cells in aggregate. The network between the projection device and the cells to be dropped contributes to a higher frequency of transformation by reducing the size of the projection aggregates, thereby reducing damage to the recipient cells by too large projections. Microprojection dropping techniques are widely used and are used to transform virtually any species. Examples of species transformed by microprojectile dropping include corn (PCT Application WO 95/06128), barley (Ritala et al., 1994; Hensgens et al., 1993), wheat (US Patent No. 5,563,055), rice (Hensgens et al., 1993), oats (Torbet et al., 1995; Torbet et al., 1998), rye (Hensgens et al., 1993), sugar cane (Bower et al., 1992), sugar cane ( Monocots and tobacco (Tomes et al., 1990; Buising and Benbow, 1994), soybeans (US Patent No. 5,322,783), sunflowers (Knittel et al. 1994) such as Casa et al., 1993; Hagio et al., 1991). ), Dicots such as peanuts (Singsit et al., 1997), cotton (McCabe and Martinell, 1993), tomatoes (VanEck et al. 1995), and overall legumes (US Patent No. 5,563,055). For release, the cells on suspension are concentrated in a filter or solid culture medium. Alternatively, immature embryos or other target cells are aligned in a solid culture medium. The cells to be dropped are placed at an appropriate distance below the microprojection stop plate. If desired, one or more networks can be placed between the accelerator and the cells to be dispensed. (iii) Agrobacterium-mediated transformation Agrobacterium-mediated delivery is a favorite system for introducing genes into plant cells because DNA can be introduced into whole plant tissues, eliminating the need to regenerate plants from protoplasts. The use of Agrobacterium-mediated plants incorporating vectors for introducing DNA into plant cells is known in the art. This method is described in Fraley et al., (1985), Rogers et al., (1987), U.S. Patent No. 5,563,055. Agrobacterium-mediated transformation is most effective in dicotyledonous plants, and is the preferred method for the transformation of dicotyledons, including Arabidopsis, tobacco, tomatoes, potatoes. Indeed, Agrobacterium-mediated transformation has been used for dicotyledonous plants for many years, but has recently been applied to monocotyledonous plants. Due to advances in Agrobacterium-mediated transformation technology, this technology is now being applied to almost all monocotyledonous plants. For example, Agrobacterium-mediated transformation can be described by rice (Hiei et al., 1997; Zhang et al., 1997; US Patent No. 5,591,616), wheat (McCormac et al., 1998), barley (Tingay et al., 1997; McCormac et al., 1998) and corn (Ishidia et al., 1996). Currently, Agrobacterium-mediated transformation vectors are readily manipulated as described above (Klee et al., 1985) and can be used for replication in E. coli and Agrobacterium. . In addition, due to technical advances in the field of vector for Agrobacterium-mediated gene delivery, the alignment of genes and restriction sites on the vector is improved, making it easy to construct vectors expressing various polypeptide coding genes. It became possible. The aforementioned vector (Rogers et al., 1987) has a polyadenylation signal for direct expression of the inserted polypeptide coding gene and a multi-link region flanking the promoter, which is suitable for the object of the present invention. In addition, Agrobacterium carrying an armed or disarmed Ti gene can be used for transformation. In these plant species, where Agrobacterium-mediated transformation is effective, it is the method of choice due to the easy and limited nature of gene transfer. (iv) other transformation methods Transformation of plant protoplasts can be achieved using methods based on calcium phosphate precipitation, polyethylene glycol treatment, electroporation, and a combination of these treatments (Portrykus et al., 1985; Lorz et al., 1985; Omirulleh et al) , 1993; Fromm et al., 1986; Uchimiya et al., 1986; Callis et al., 1987; Marcotte et al., 1988). The application of these systems to different plant strains is due to their ability to regenerate certain plant species from protoplasts. Examples of methods for reproducing grain from protoplasts have been described (Fujimara et al., 1985; Toriyama et al., 1986; Yamada et al., 1986; Abdullah et al., 1986; Omirulleh et al., 1993 and US Patent No. 5,508, 184). Examples of direct inhalation transformation of grain protoplasts include rice (Ghosh-Biswas et al., 1994), sugar cane (Battraw and Hall, 1991), barley (Lazerri, 1995), oats (Zheng and Edwards, 1990), corn ( Omirulleh et al., 1993). To transform plant species that cannot be reproduced from protoplasts, other methods of introducing DNA into intact cells and tissues can be used. For example, regeneration of grain from an immature embryo or explant may be performed as described above (Vasil, 1989). Silicon carbide fiber-mediated transformation is also used with or without protoplast formation (Kaeppler, 1990; Kaeppler et al., 1992; U.S. Patent No. 5,563,055). Transformation through this technique is accomplished by stirring the silicon carbide fibers with the cells in a DNA solution. DNA enters the cell passively as it is punctured. This technique can be used successfully in monocot corn (PCT Application WO 95/06128; Thompson, 1995) and rice (Nagatani, 1997). IV. Optimization of microprojection drop For microprojection drop transformation according to the present invention, physical and physiological parameters are optimized. Physical factors are factors associated with manipulating DNA / microprojectile deposits or factors affecting the flight and speed of macro- or microprojectiles. Biological factors include all stages involved in the manipulation of cells before and after release, such as adjusting the osmotic pressure of target cells to mitigate trauma associated with release, the direction of immature embryos or other target tissues associated with particle trajectory, transformation The nature of the resulting DNA (eg, linearized DNA or intact hyperhelix plasmid). Line-off manipulation is particularly important for successful transformation of immature embryos. Thus, with small scale studies to fully optimize the conditions, it is desirable to adjust various dosing parameters. In particular, it is desirable to adjust physical variables such as DNA concentration, gap distance, flight distance, tissue distance, helium pressure. In addition, the grade of helium also affects transformation efficiency. For example, although it is not known which is more beneficial for release, differences in transfection efficiency have been identified with release using industrial grade helium (99.99% purity) or ultra-high purity helium (99.999% purity). Trauma reduction factors (TRFs) can be optimized by modifying conditions that affect the physiological state of the recipient cells and thus affect transformation and integration efficiency. For example, the osmotic state, tissue hydration and passage state, or the cell cycle of the recipient cells can be adjusted for optimal transformation. Physical and chemical variables for release can be processed for further optimization of projection transformation. Physical factors are factors associated with manipulating DNA / matoprojectile precipitates or those that affect the flight and speed of macro- or microprojectiles. Biological factors include all steps involved in the manipulation of cells immediately before and after projection. Pre-projection culture conditions such as osmotic environment, projection parameters, and plasmid morphology are adjusted to produce the maximum number of stable transformants. (i) physical variables 1.thickness distance The transition nest (large hold) can be adjusted by varying the distance, ie the spacing distance, between the rupture disc and the giant shoot. This distance is 0-2 cm. As the spacing is further reduced, the speeds of giant and microinjections increase, shock waves (inducing tissue frying and tissue trauma increase), and microprojectiles are expected to penetrate deeper. Longer interval lengths, on the contrary, are expected to increase viability, thus increasing the total number of stable transformants recovered. 2. Fly distance Fixed nests (included in variant nests) can vary between 0.5 and 2.25 cm with a predetermined 0.5 cm placement increment of the spare ring where the macropectar adjusts the flight path. Shorter flight paths increase the stability of the large projectile in flight, but reduce the overall velocity of the microprojection. As stability increases in flight, the number of central GUS loci increases. Longer flight distances (up to a certain point) increase speed while flight instability increases. Based on the observation, the projection is preferably performed with a flight path length of 1.0 cm to 1.5 cm. 3. Organization distance The location of tissue in the gun chamber can have a significant impact on microprojection penetration. As the flight path of the microprojection increases, the trauma associated with speed and shock waves is reduced. Also, as the speed decreases, the penetration of the microprojection becomes thinner. 4. helium pressure By manipulating the shape and number of bursting discs, the pressure can be varied from 400 to 2000 psi in the gas acceleration tube. The optimal pressure for stable transformation is determined from 1000 to 1200 psi. 5. Coating of microprojection For microprojection release, DNA attaches to the microprojection (“coating”) and delivers it to the recipient cells in a form that is stable for transformation. In this respect, at least a portion of the transforming DNA should be the target cell of the transformation and at the same time the DNA should attach to the microprojection during delivery. Thus, the availability of transformed DNA from microprojectiles may include physical reversal of the binding between the transformed DNA and the microprojectiles after the microprojectiles are delivered to the target cell. However, this is not necessary because the availability to the target occurs as a result of rupture of unbound fragments of DNA or other molecules that are physically attached to the microprojectiles. Availability may be due to the rupture of the bond between the transforming DNA and other molecules, which DNA and molecules attach directly or indirectly to the microprojection. In addition, transformation of the target cell can occur by direct recombination between the transforming DNA and the genomic DNA of the recipient cell. For that reason, the "coated" microprojectiles in this article can be used to transform target cells in that the transgenic DNA is delivered to the target cells or facilitates access to the target cells so that transformation occurs. . Any technique for coating microprojectiles capable of delivering the transformed DNA to target cells is used. Microprojection coating methods suitable for the present invention are specifically presented herein. However, DNA can be bound to microprojectile particles using other techniques. For example, the particles can be coated with DNA ends labeled with streptavidin and long chain thiol cleavable biotinylated nucleotide chains. DNA attaches to the particles due to streptavidin-biotin interactions and is released from the cell by a reduction in thiol binding through reducing agents present in the cell. Alternatively, the particles can be made to functionalize the surface of the gold oxide particles to provide free amine groups. DNA with a strong negative charge will bind to the functionalized particles. In addition, the charged particles are precipitated in the form of a controlled array on the surface of the mylar pliers disk in the PDS-1000 projection device, facilitating controlled dispersion of the particles to be delivered to the target tissue. As mentioned above, the concentration of DNA used to coat the microprojectiles is expected to affect the harvest of transformants with a single copy of the foreign transgene. For example, low concentrations of DNA do not alter the efficacy of transformation, but may instead increase the rate of single copy insertion. In this aspect, approximately 1 ng to 2000 ng of transgenic DNA can be used per 1.8 mg of starting microprojectiles. In another embodiment of the invention, 2.5ng to 1000ng, 2.5ng to 750ng, 2.5ng to 500ng, 2.5ng to 250ng, 2.5ng to 100ng, 2.5ng to 50ng of transformed DNA per 1.8mg of starting microprojection Can be used. Various other methods can be used to increase transformation efficacy or to increase the relative proportion of low-copy transformation phenomena. For example, the present inventors consider a method of modifying the ends of the transformed DNA with alkaline phosphatase or a drug that truncates the pre-transformed DNA ends. In addition, inert carrier DNA can be included in the transformed DNA to lower the effective transformed DNA concentration without reducing the total amount of DNA used. These techniques are described in U.S. Patent application No. 08 / 995,451, filed Dec. 22, 1997, which is incorporated herein by reference. (ii) biological variables Culture conditions and other variables can affect the physiology of target cells and can have a profound effect on transformation and integration efficiency. First, the projection action can promote the production of ethylene, which can lead to aging of the tissue. Anti-ethylene compounds can be shuffled to increase transformation efficacy. Second, it is expected that the specific point in the cell cycle will be more appropriate for the integration of the DNA to be introduced. Thus, cell cultures can be synchronized to enhance the viability of transformants. For example, synchronization can be accomplished using cryotreatment, amino acid depletion or other cell cycle-stopping drugs. Third, the degree of tissue hydration may also contribute to the amount of trauma associated with projection and the ability of microprojectiles to penetrate the cell wall. The location and orientation of the vessel or other target tissue in relation to the particle trajectory is also important. For example, the PDS-1000 projection device does not spread particles evenly over the surface of the target petri dish. The particle velocity at the center of the plate is faster than the particle velocity at a further distance from the center of the Petri dish. Therefore, in order to avoid the center of the dish (referred to as the "dead zone"), it is desirable to position the target tissue in the petri dish. It is expected that the tissue most likely to regenerate the plant should be directed towards the particle stream. For example, blastocysts of immature embryos should be composed of cells with maximum embryogenic potential and, therefore, should be directed towards particle flow. It has also been reported to increase transgenic efficacy in yeast cells that caused some protoplasts (Armaleo et al., 1990). Here, it is assumed that the modified osmotic state of the cells helps to reduce the trauma associated with the penetration of the microprojection. In addition, growth and cell cycle stages are important in terms of transformation. 1. Osmotic pressure adjustment Osmotic pre-treatment is known to significantly reduce projection-related damage due to reduced swelling of protoplasted cells. In previous studies, the number of transiently expressing GUS cells increased after passage in fresh and osmotic media (PCT Application WO 95/06128). It was found that the number of GUS expression loci increased significantly during the 90 minute treatment time than the shorter time. Cells incubated in 500 mOSM / kg medium for 90 minutes showed a temporary GUS locus, 3.5 times greater than the control. Preferably, immature embryos are preincubated 4-5 hours before being projected onto culture medium containing 12% sucrose. The first culture in 12% sucrose was carried out for 16-24 hours after projection. Alternatively, type II cells are pretreated in 0.2 M mannitol for 3-4 hours prior to projection. Pretreatment of cells with other osmotic solutes for 1-6 hours is also expected to be desirable. 2. Plasmid form In some cases, it is desirable to deliver DNA to corn cells that do not have the DNA sequences required for maintenance of the plasmid vector in bacterial hosts such as E. coli, eg, antibiotic resistance genes and DNA prokaryotic origins. The resistance genes include, but are not limited to ampicillin, kanamycin, and tetracycline resistance genes. In such cases, DNA fragments carrying the transformed DNA are purified prior to transformation. A typical purification method is gel electrophoresis on 1.2% agarose gel with low melting point, followed by 6-10 fold excess ris-EDTA buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA, 70 ° C-72 ° C). The procedure was dissolved and harvested from agarose gel; Freeze and thaw (37 ° C.); The agarose gel is centrifuged to pellet. Thereafter, the DNA is purified using a Qiagen Q-100 column. For effective collection of DNA, the flow rate of the column is adjusted to 40 ml / hr. Isolated DNA fragments can be harvested from agarose gels using a variety of electrolysis techniques, enzymatic cleavage of agarose or binding of DNA and free beads (eg Gene Clean). In addition, DNA fragments can be isolated using HPLC or magnetic particles. As an alternative to DNA fragment isolation, the plasmid vector can be digested with restriction enzymes and delivered to maize cells without prior purification of the expression cassette fragment. V. Receptor Cells for Transformation Tissue culture requires a medium and a controlled environment. "Medium" means a number of nutrient mixtures that are used to grow cells in vitro, i.e., outside of a complete living body. In general, the medium is a suspension composed of various kinds of components (salts, amino acids, growth regulators, sugars, buffers) necessary for the multi-cell type sexual well. However, each specific cell type requires a specific range of component ratios for growth and a more specific range of prescriptions for optimal growth. Cell growth rates vary in cultures disclosed in the arrangement of the medium in which the cell types are grown. Nutritious media are made from liquids, but can be solidified by adding liquids to substances that can provide a solid foundation. Aga is the most commonly used for this purpose. Bactoagar, Hazelton agar, Gelrite and Gelgro are solid supports suitable for the growth of plant cells in tissue culture. Some cell types are grown and differentiate in liquid suspension or solid medium. As noted in this article, corn cells are grown in suspension or solid medium, but the liquid medium must be changed to solid medium at some point in development to regenerate suspended cultured plants. The type and extent of differentiation of the cells in culture is affected by the type of medium (solid or liquid) as well as the type of medium and environment used (eg pH). Table 2 shows the compositions of various media useful for the production of receptive cells and plant regeneration. Receptor cell targets include meristem cells (including shoot apex (US Patent 5,736,369), type I, type II, type III callus), immature embryos, germ cells (vesicles, pollen, sperm, egg cells) It is not limited to. Any cell from which a viable plant can be regenerated is thought to be useful as a recipient cell. Type I, II and III callus tissues originate from tissue sources, which include, but are not limited to, immature embryos, normal meristem cells of seedlings, and vesicles. Cells that can proliferate as callus also become recipient cells for gene transformation. The present invention provides a technique for transforming an immature embryo and then regenerating a viable transgenic plant. When transforming immature embryos, long-term development of the recipient cell culture is unnecessary. Pollen and its precursor vesicles can function as vectors for introducing foreign DNA that is incorporated during fertilization or fertilization for gene mutation. Direct pollen transformation can avoid the need for cell culture. Meristem cells (i.e. plant cells characterized by undifferentiated cytological appearance that are capable of sustained cell differentiation and are commonly found at plant growth points (e.g., root tip, hepatocellular apex, side shoots)) Representative different forms of cells. Due to their undifferentiated growth and organ differentiation and pluripotency ability, one transformed meristem cell can be capped into whole transformed cells. Indeed, embryogenic suspension cultures are expected to become meristem cell systems in vitro and continue to retain the ability to continue to differentiate in an undifferentiated state controlled by the medium environment. Cultured plant cells that can serve as recipient cells for transformation into the desired DNA segment include any cells, including grain cells, more specifically, Zea mays L cells. Somatic cells exist in various forms. Embryonic cells are a type of somatic cell for regenerating plants through embryogenesis. Non-embryogenic cells are cells that do not correspond in this way. An example of a non-embryogenic cell is a Black Mexican Sweet (BMS) grain cell. In the present invention, for example, the development of embryogenic maize callus tissues and suspension cultures useful as recipient cells for transformation are described in U.S. Pat. Patent No. 5,134,074 and U.S. Patent No. 5,489,520, which are incorporated herein by reference. Certain techniques can be used to increase the amount of recipient cells within a cell population. For example, the development of type II callus and subsequent manual selection and cultivation of fragile embryogenic tissues increases the amount of recipient cells available for microprojectile transformation. In particular, suspension culture using a medium as described in this article can improve the ratio of recipient cells to non-receptor cells in any population. Manual selection techniques used to select recipient cells include assessing cell morphology and differentiation, or using a variety of physical or biological means. Cryopreservation is also one of the methods for selecting recipient cells. Manual selection of recipient cells, for example, the selection of embryogenic cells from the surface of the Type II callus, is a means used to increase the amount of recipient cells prior to culture (whether in culture or suspension). It is one of them. Appropriate cells are cells located on the surface of the cell cluster, which can be identified by a lack of differentiation, size and dense cytoplasm. In general, suitable cells are cells that are less or less differentiated. Therefore, it is desirable to identify and select cells that are densely cytoplasmic, have no vacuoles at high nucleus-to-cytoplasmic ratios, are small in size (10-20 μm), and are capable of sustained differentiation and somatic proembryo. Do. Other means of identifying such cells may also be used. For example, using a dye such as Evans Blue, which is excluded by cells having relatively non-permeable membranes (eg embryogenic cells) and relatively differentiated cells (eg root-shaped cells and snake cells). (Similar in form to a snake)). Other means of identifying recipient cells include the use of isoenzymatic marks of embryogenic cells, such as glutamate dehydrogenase, which can be detected by cytochemical staining (Fransz et al., 1989). . However, care should be taken when using isoenzyme marks, including glutamate dehydrogenase, as some false positives can result from non-degenerative cells (eg, root-shaped cells) that possess relatively high metabolic activity. (i) Receptor cell culture for transformation The ability to prepare and cryopreserve cultures of corn cells is important in the present invention in that it provides a means for regeneratively preparing cells for transformation. Many different media have been previously developed and can be used to practice various aspects of the present invention. The following table (Table 2) provides the preferred media compositions of the present inventors for practicing these aspects of the present invention. Table 2a Table 2b Table 2c Table 2d Table 2e Table 2f Table 2g Table 2h Table 2i Table 2j Table 2k Table 2l Table 2m Table 2n Many typical corn cultures that can be used for transformation are presented in PCT application WO 95/06128, which publication is incorporated herein by reference. (ii) badge In certain embodiments of the invention, the recipient cells are selected after growing in the medium. Cultured cells used can be grown on solid supports or liquid suspensions. In either case, nutrition provides the cells in media form and in a controlled environment. There are many tissue culture media consisting of various amino acids, salts, sugars, growth regulators, and vitamins. Most of the media used in the practice of the present invention have some similar components (Table 2), but the composition and proportion of the components will vary depending on the intended use. For example, various cell types grow in more than one type of medium, but show different growth rates and morphologies depending on the growth medium. In some media, cells survive but do not differentiate. Various forms of media suitable for the cultivation of plant cells have been described. Examples of such media include, but are not limited to, N6 medium (Chu et al. (1975)) and MS medium ((Murashige and Skoog, 1962)). Medium, such as MS with a high ammonia / nitrate ratio, has been found to counteract regeneration of recipient cells in that it promotes loss of morphogenesis. On the other hand, N6 medium has a rather low ammonia / nitrate ratio and is expected to promote the regeneration of the recipient cells by maintaining the cells in a continuously differentiated embryogenic state. (iii) maintenance The method of maintenance of cell culture contributes to their utility as a recipient cell source for transformation. Manual selection of cells for transfer to new culture medium, frequency of transfer to new culture medium, composition of the culture medium, and environmental factors (including optical properties, quantity and temperature) maintain the useful tissue or suspension culture as a source of recipient cells. It is an important factor. Modification of callus tissues at different culture conditions is expected to help increase the amount of recipient cells in the culture. For example, cells may be cultured in suspension and transferred to solid medium at regular intervals. After growing for a period of time in solid medium, the cells can be selectively screened and reduced to a liquid culture medium. Transferring to fresh culture medium may be repeated to increase the amount of recipient cells. In addition, passing the cell culture through the 1.9 mm sieve is useful for maintaining the softness of the callus or suspension culture and is expected to be effective in increasing the amount of transformable cells. (iv) cryopreservation methods Cryopreservation is important because it eliminates the deleterious effects associated with prolonged incubation periods, while maintaining and preserving known transformable cell cultures for future use. Cell suspensions and callus can be cryopreserved by modifying previously known methods (Finkle, 1985; Withers & King, 1979). The cryopreservation protocol consists of the progressive addition of the pre-frozen (0 ° C.) concentrated cryopreservation mixture to the pre-cooled (0 ° C.) cells. The mixture is kept at 0 ° C. throughout this period. The volume of cryopreservant added corresponds to the initial volume of cell suspension (1: 1 addition) and the final concentration of cryopreservative additive is 10% dimethyl sulfoxide, 10% polyethylene glycol (6000 MW), 0.23 M proline, 0.23 M Glucose. The mixture was equilibrated at 0 ° C. for 30 minutes, in which the cell suspension / freezing mixture was divided into 1.5 ml aliquots (0.5 ml compressed cell volume) in a 2 ml polyethylene cryo-vial. The tube was cooled to 0.5 ° C./min to −8 ° C. and kept at this temperature for ice nucleation. Once extracellular ice formation was visually confirmed, the tube was cooled from -8 ° C to -35 ° C at 0.5 ° C / min. They are held at this temperature for 45 minutes (to ensure even freeze-induced dehydration during whole cell aggregation). At this point, the cell loses most of its osmotic volume (ie, there is little free water left in the cell) and can be stably put in liquid nitrogen for storage. Rapid cooling in the range of -35 ° C. to −196 ° C. results in the lack of free water remaining in the cells, resulting in the formation of largely organized ice crystals. Cells are stored in liquid nitrogen, which effectively fixes cells and delays metabolism until a point where long-term storage is not harmful. Thawing of the extracellular solution was achieved by removing the cryo-tubes from the liquid nitrogen and stirring in 42 ° C. sterile water for approximately 2 minutes. The tube blocks the heat immediately after the last ice crystal melts, preventing the heating of the tissue. The cell suspension (in the cryopreservation mixture) is pipetted in a filter and placed on the BMS cell layer (the nutrient layer that provides nutrients during recovery). Cryopreservation solution is removed by pipetting. The culture medium consists of callus tissue growth medium with increased osmotic strength. Cryopreservation dilutes slowly as the solution diffuses through the filter and the nutrients are upwardly diffused into the recovery cells. Once continuous growth of thawed cells was observed, growth tissue was transferred to new culture medium. When the incubation of the suspension culture was required, the cell mass was reduced to the liquid suspension medium immediately after the cell mass was increased again (generally within 1 to 2 weeks). Alternatively, cells were cultured in solid callus growth medium. Cultures were reestablished in liquid (additionally within 1 to 2 weeks) and used for transformation experiments. If desired, previously cryopreserved cultures can be frozen once more for storage. VI. Production and Characterization of Stable Transgenic Corn After delivering exogenous DNA to recipient cells, the next step is to identify transformed cells for further culture and plant regeneration. As noted above, to enhance the ability to identify transformants, it is desirable to use selectable or selectable mark genes as the expressible gene of interest. In such cases, the cells are exposed to selective drugs to generally analyze the potentially transformed cell population or to select cells for the desired mark gene properties. (i) screening DNA is believed to be introduced only in very small percental target cells in any experiment. In order to provide an efficient system for identifying cells that absorb DNA and integrate it into the genome, means for selecting stably transformed cells can be used. A typical example of such a means is the introduction of a mark gene into a host cell that confers resistance to some normally inhibited drug such as an antibiotic or herbicide. Examples of antibiotics that may be used include aminoglycoside antibiotics (neomycin, kanamycin, parromycin) or antibiotic hygromycin. Resistance to aminoglycoside antibiotics is bestowed by aminoglycoside phosphotransferase enzymes such as neomycin phosphotransferase II (NPT II) or NPT I and resistance to hygromycin is hygromycin. Donated by phosphotransferase. Potentially transformed cells are then exposed to selective drugs. Survival cell populations are generally cells in which the resistance-donating gene has been integrated and exposed to sufficient levels to allow cell survival. Cells may be further tested to confirm stable integration of exogenous DNA. Using the technique presented in this article, transformants can be produced in more than 40% of the embryos projected. Herbicides, which have been suggested as preferred screening drugs, are bialaphos, a broad range of herbicides. Bialaphos is a tripeptide antibiotic made from Streptomyces hygroscopicus, consisting of phosphinothricin (PPT), an analog of L-glutamic acid, and two L-alanine residues. Immediately after removal of L-alanine residues by intracellular peptidase, PPT is released, a potent inhibitor of glutamine synthetase (GS), a central enzyme involved in ammonia assimilation and nitrogen metabolism (Ogawa et al., 1973). ). Synthetic PPT active in herbicide Liberty TM is also effective as a screening drug. Inhibition of GS by PPT in plants causes rapid accumulation of ammonia and death of plant cells. Microorganisms producing bialaphos and other species of Streptomyces also synthesize phosphinothricin acetyl transferase (PAT), an enzyme that forms the bar gene in Streptomyces hygroscopicus. Encoded by the pat gene in Streptomyces viridochromo genes. The use of herbicide resistant genes encoding phosphinothricin acetyl transferase (PAT) is shown in DE 3642 829 A, wherein the gene is isolated from Streptomyces viridochromo genes. In bacterial source microorganisms, this enzyme acetylates the free amino group of PPT that prevents autotoxins (Thompson et al., 1987). The bar gene is cloned (Murakami et al., 1986; Thompson et al., 1987), transgenic tomatoes, tobacco, potatoes (De Block, 1987), Brassica (De Block, 1989), corn (US Patent No. 5,550,318). ). In previous reports, some transgenic plants expressing resistant genes have been completely resistant to commercial production of PPT and bialaphos in greenhouses. A typical example of herbicides useful for the selection of transformed cell lines in the practice of the present invention is glyphosate, which is a broad range of herbicides. Glyphosate inhibits the action of EPSPS enzymes that are active in the aromatic amino acid synthesizing pathway. Inhibition of these enzymes leads to depletion of the amino acids phenylalanine, tyrosine, tryptophan and their secondary metabolic derivatives. U.S. Patent No. In 4,535,060, the isolation of the Salmonella typhimurium gene, EPSPS mutation, which confers glyphosate resistance to aroA against EPSPS is described. The EPSPS gene was cloned from corn and a mutation similar to that found in the glyphosate aroA gene was introduced in vitro. Variant genes encoding glyphosate resistant EPSPS enzymes are described in international application WO 97/4103. The most characteristic variant EPSPS that confers glyphosate resistance includes amino acid changes at residues 102 and 106, but other mutations are also expected to be useful (PCT / WO97 / 4103). To use the bar-bialaphos or EPSPS-glyphosate screening system, the projected tissues were incubated for 0-28 days in non-selective media, followed by 1-3 mg / l bialophos or 1-3 Transferred to a medium containing mM glyphosate as appropriate. Although 1-3 mg / l bialophos or 1-3 mM glyphosate is generally preferred, 0.1-50 mg / l bialophos or 0.1-50 mM glyphosate would be useful in the practice of the present invention. It is expected. Tissue can be placed on any pore inert solid or semi-solid support for projection, which includes, but is not limited to, filters and solid culture media. Bialophos and glyphosate are given as examples of drugs suitable for the selection of transformants, but the technology of the present invention is not limited thereto. In addition, the herbicide DALAPON (2,2-dichloropropionic acid) is expected to be useful for the identification of transformed cells. 2,2-diclopropionic acid dihalogenase (deh) inactivates the herbicidal activity of 2,2-dichloropropionic acid and, thus, is herbicide resistant to cells or plants expressing genes encoding the dihalogenase enzyme. (Buchanan-Wollaston et al., 1992; PCT Application WO 95/06128; US Patent No. 5,508,468; US Patent No. 5,508,468). Alternatively, a gene encoding an anthranilate synthase that confers resistance to certain amino acid analogs, such as 5-methyltryptophan or 6-methylanthranilate, may be used as the selectable mark gene. Use of anthranilate synthase as a selectable gene is described in U.S. Patent No. 5,508,468 and U.S. It is described in patent application 08 / 604,789. An example of a selectable mark property is a red pigment produced under the R-position control of corn. This pigment can be detected by culturing the cells in a solid support containing a nutrient medium capable of supporting growth at this stage and selecting cells from stained colonies (visible aggregates of cells). These cells are further cultured in suspension or solid medium. The R-position is useful for the selection of transformants from projected, immature embryos. Similarly, the introduction of the C1 and B genes results in the production of stained cells and tissues. Luciferase can be used as a selectable mark within the scope of the present invention. Cells expressing luciferase in the presence of the substrate luciferin can be detected in photographs or x-ray films in luminescence counters (or liquid scintillation counters), by means of enhancing the suggestion, or by highly photosensitive video cameras (photon counting cameras). Can emit light. Both of these assays are nondestructive and the transformed cells can be further cultured after identification. Photon counting cameras are particularly valuable because they can identify specific cells or cell populations expressing luciferases and manipulate them in real time. Another selectable mark that can be used is a gene encoding a green fluorescent protein (Sheen et al., 1995). In addition, selectable and selectable marks can be combined and used for identification of transformed cells. In some cells or tissue types, the selection drug, such as nonalophos or glyphosate, does not provide sufficient lethal action to clearly recognize the transformed cells, or At the same time, non-selective inhibition may be used to disable the screening technique. When selected using sub-estose inhibitory compounds (e.g., non-alophos or glyphosate) to induce 100% inhibition, and then selecting growth tissue for expression of selectable mark genes such as luciferase, It is anticipated that single screening will allow for the collection of transformants from intractable cells or tissue types. By combining selection and selection, transformants can be identified in a wider range of cells and tissue types. (ii) recycling and seed production Cells that survive exposure to selective drugs or cells that are positive in the screening assay can be cultured in a medium that supports plant regeneration. In one embodiment, MS and N6 media can be modified by including additional substances, such as growth regulators (see Table 2). Suitable growth regulators for this purpose are dicamba or 2,4-D. However, other growth regulators can be used including NAA, NAA + 2,4-D or picloram. Media improvement in this manner has been found to facilitate the growth of cells at certain stages of development. Tissue is maintained in basal medium containing growth regulators until sufficient tissue initiates plant regeneration or after several manual selections the tissue morphology is suitable for regeneration (at least 2 weeks), and then Transfer to media that induce maturation. Cultures are transferred to this medium every two weeks. Germination indicates time to transfer to growth regulator deficient medium. Transformed cells, identified by selection or selection, and cultured in appropriate media to support regeneration are then matured into plants. Developing plant fragments are transferred to a soil-free plant growth mixture and cured in an environmentally controlled chamber of 85% relative humidity, 600 ppm CO 2 , 25-250 microein m −2 s −1 . Plants are matured, preferably in growth chambers or greenhouses. Plants are regenerated 6 to 10 months after identification of the transformants depending on the starting tissue. During regeneration, cells are grown in solid medium in tissue culture vessels. Examples of such containers include Petri dishes and plant Cons. Regenerated plants are regenerated, preferably at 19-28 ° C. The regenerated plants reach the germination and root development stages and are then transferred to the greenhouse for further growth and testing. However, it is noted that in transformed plants, the core sometimes requires salvage due to interruption of core development and premature aging of the plant. To rescue developing embryos, they are excised from the surface-uninfected centers after 10-20 days and cultured. The medium used for this step consists of MS salt, 2% sucrose, 2.5 g / L agarose. In embryo rescue, large embryos (defined as more than 3 mm long) are germinated directly in a suitable medium. Smaller embryos were incubated for one week in a medium containing the components with 10 −5 M absic acid and then transferred to growth regulator-free medium for germination. Descendants were harvested from the transformed plants and tested for expression of exogenous expressible genes by applying appropriate substrates locally to plant parts (eg leaves). In the case of bar transformed plants, the transformed parent plants (R O ) and any descendant generations thereof, after topically applying the herbicide Basta to the leaves, have no functional PAT activity on the plants as in in vitro enzyme assays. If present, it was found to show non-alaphos-independent necrosis. All PAT positive descendants examined carry bar, demonstrating that the presence of the enzyme and resistance to non-allophos are associated with the propagation of the mark gene through the germ line. (iii) characterization Various assays can be performed to confirm the presence of exogenous DNA or “foreign transgenes” in regenerated plants. Such assays include "molecular biological assays" (eg, Sudden and Nozan Blotting and PCR TM ); "Biochemical analysis" (eg, detection of the presence of protein products by immunological means (ELISA and Western bloat) or enzymatic function); Plant part analysis (eg, leaf or root analysis); Phenotypic analysis of whole regenerated plants is included. 1. DNA integration, RNA expression and heredity Genomic DNA is isolated from the callus cell line or any plant part to determine the presence of exogenous genes using techniques known to those skilled in the art. Note that there is not always a sequence intact due to rearrangement or deletion of the sequence in the cell. The presence of DNA elements introduced through the method of the present invention can be determined by polymerase chain reaction (PCR ™ ). Using this technique, individual fragments of DNA are amplified and detected by gel electrophoresis. Such an assay can determine whether a gene is present in a stable transformant, but cannot demonstrate the integration of the introduced gene into the host cell genome. However, it can be seen empirically that DNA is integrated into the genome of all transformants showing the presence of the gene through PCR TM analysis. In addition, PCR ™ techniques cannot be used to determine whether the transformant has an exogenous gene that is introduced into a different location on the genome, that is to say that the transformant is from an independent source. Using PCR ™ technology, it is expected that it will be possible to clone fragments of host genomic DNA adjacent to the introduced gene. Positive evidence of host genome integration of DNA and independent identity of transformants can be determined using Southern hybridization techniques. This technique can be used to identify host DNA sequences adjacent to specific DNA sequences introduced into the host genome. Therefore, the Southern hybridization pattern of any transformant serves to verify the properties of the transformant. Sudden hybridization can also explain the presence of the transgene in high molecular weight DNA, ie, demonstrate that the transgene is integrated into the host cell genome. Sudden hybridization techniques not only show the information obtained using PCR ™ , such as the presence of genes, but also demonstrate integration into the genome and characterize each individual transformant. Whether using a variation of the datteu or slot blot hybridization of the hybridization technique, for the same information, for example, resulting from the PCR TM, it can be obtained for the presence of the gene. Both PCR TM and sudden hybridization techniques can be used to demonstrate exogenous transduction to descendants. In most cases, the characteristic sudden hybridization pattern for any transformant is separated from descendants by one or more Mendelian genes (Spencer et al., 1992), which indicates a stable inheritance of the foreign transgene. Hints. DNA analysis techniques are carried out using DNA isolated from any part of the plant, while RNA is only expressed in specific cells or tissue types, and therefore it is necessary to make analytical RNA from these tissues. In addition, PCR TM can be used for detection and quantitation of RNA produced from introduced genes. Upon application of PCR TM, using enzymes such as reverse transcriptase and an RNA reverse transcriptase to the DNA, since it is necessary to amplify the DNA using conventional PCR technology TM. In most cases, PCR TM techniques are useful but do not demonstrate the integrity of RNA products. Information on the nature of RNA products is not available by Nozanne blotting. This technique demonstrates the presence of RNA species and provides information on the integrity of RNA. In addition, the presence or absence of RNA species can be determined using dot or slot blot nozane hybridization. These techniques are modifications of nozan blotting, demonstrating only the absence or presence of RNA species. 2. Gene Expression Nozan blotting and PCR TM can be used to detect questionable genes, but they do not provide information on whether the genes are expressed. Expression can be assessed by identifying the protein products of the integrated genes or by specifically identifying the phenotypic changes resulting from their expression. Assays for the production and identification of specific proteins utilize the properties of physical-chemical, structural, functional or other proteins. Through unique physical-chemical or structural properties, proteins can be isolated and identified by electrophoretic processes (e.g. intrinsic or modified gel electrophoresis or isoelectric confocal) or by chromatography techniques (e.g. ion exchange or gel exclusion chromatography). have. The unique structure of the individual proteins offers the opportunity to detect their presence in the form of ELISA assays with specific antibodies. Merging schemes such as western blotting are more specifically used, where antibodies are used to locate individual gene products separated by electrophoretic techniques. To absolutely identify the identity of the product of interest, additional techniques such as evaluation by amino acid sequencing after purification can be used. Although these processes are the most commonly used, other processes can be used. In addition, analytical procedures can be used to confirm the expression of proteins with the ability of enzymes to catalyze functional, in particular, specific chemical reactions involving specific substrates and products. After these reactions, loss of substrate or regeneration of the reaction product by physical or chemical processes is provided and quantified. Examples are as varied as the enzymes to be analyzed, including PAT enzymatic activity after production of radiolabeled and acetylated phosphinothricin from phosphinothricin and 14 C-acetyl CoA, or anthranilate synthesis after fluorescence loss of anthranilate Assays for enzyme activity are included. Expression of gene products is largely determined by evaluating the phenotypic results of expression. These assays take a variety of forms, including but not limited to analysis of changes in chemical composition, structure, or physiological properties of plants. Chemical compositions can be modified by changing the amino acid composition and by enzymes that can be detected by amino acid analysis or by expression of genes encoding storage proteins, or by enzymes that change the amount of starch that can be analyzed by near infrared reflectance spectrophotometry. . Structural changes include larger kidneys and thicker stems. Most changes in response to the applied treatment of plants or plant parts are assessed under carefully controlled conditions called bioanalysis. VII. Reproduction of Plant of the Invention In addition to direct transformation of specific phenotypes using the constructs of the present invention, plants having the constructs of the present invention can be hybridized with a second plant without the constructs to make the plants of the present invention. Thus, the present invention includes not only plants directly regenerated from cells transformed according to the present invention, but also descendants of such plants. As used herein, "progeny" means any descendant of a parent plant made in accordance with the present invention. "Hybrid", which provides a plant system with one or more added foreign introduction genes relative to the starting plant system presented in this article, hybridizes the donor plant system and the starting system, including the foreign introduction gene of the present invention, to the foreign introduction gene of the present invention. It is defined as a technique for integrating a system into a plant system. To achieve this, generally the following steps are taken: (a) plant seeds of the first parent plant (starting system) and the second parent plant (donor plant system comprising the foreign introduction gene of the present invention); (b) growing seeds of the first and second parent plants into flowering plants; (c) pollinate the female flower of the first parent plant and the pollen of the second parent plant; (d) harvest seeds from parent plants with female flowers; Reverse hybridization is carried out in the following steps: (a) hybridize a first genotype plant having a desired gene, DNA, sequence or element and a second genotype plant lacking the desired gene, DNA, sequence or element; (b) selecting one or a plurality of descendant plants bearing the desired genes, DNAs, sequences or elements; (c) hybridize offspring and plants of the second genotype; (d) Repeat steps (b) and (c) to transfer the desired gene, DNA, sequence or element of the first genotype plant to the second genotype plant. Genetic infiltration of DNA elements into plant genotypes is defined as the result of the reverse hybridization conversion process. Plant genotypes in which the DNA sequence has been genetically penetrated are referred to as reverse hybridized genotypes, lineages, syngeneic or hybrids. Similarly, plant genotypes lacking the desired DNA sequence are referred to as unconverted genotypes, lineages, syngeneic or hybrids. VIII. Genetic introduction of plants A particular improvement in the present invention is that it provides an improved method for expressing foreign genes, including mark genes and others. Such exogenous genes are not only genes that direct expression of a particular protein or polypeptide product, but may also be non-expressed DNA segments, such as transposons such as Ds that do not hold their own position. As used herein, "expressable gene" is any gene that can be transcribed into RNA (eg, mRNA, antisense RNA) or translated into a protein as a property of interest, including selectable, selectable or non-selective. Possible mark genes are included. In the present invention, when an expressionable gene other than the mark gene is used in parallel with the mark gene, it is expected that individual genes on the same or different DNA segments for transformation can be used. In the latter case, different vectors are co-delivered to recipient cells to maximize cotransformation. The choice of specific DNA to deliver to recipient cells depends on the purpose of the transformation. One of the primary purposes of the transformation of grain plants is to add to the plants commercially desirable and agriculturally important properties. These properties include herbicide resistance or resistance; Insect resistance or resistance; Disease resistance or resistance (viruses, bacteria, fungi, nematodes); Stress resistance or resistance (eg, drought, heat, cold, cold, excessive moisture, resistance to or salt stress); Oxidative stress; Improved yield rate; Food content and composition; Appearance; Male fertilization; Drydown; safety; Fertility; Starch properties; Oil content and quality, but not limited to these. One or a plurality of genes that confer such desired properties can be incorporated, for example, genes encoding herbicide resistance. In certain embodiments, the present invention provides a method of transforming a recipient cell with one or more beneficial foreign introduction genes. One or a plurality of exogenous genes may be provided as a single transformation phenomenon using a separate exogenous gene-encoding vector, or a single vector incorporating one or a plurality of gene coding sequences. Of course, if desired, herbicides, insects, diseases (viruses, bacteria, fungi, nematodes), or foreign resistance genes that donate resistance, male fertilization, drydown, stability, fertility, starch properties, oil content and quality, or yield It is also possible to use two or more of the aforementioned introduced genes, such as those introduced to improve the rate or nutritional quality. It is known in the art to introduce almost any DNA composition by any transformation technique and ultimately to produce a propagating transgenic plant. Construction of vectors that can be used in accordance with the present invention are known to those skilled in the art in view of this publication (eg, Sambrook et al., 1989; Gelvin et al., 1990). The technique of the present invention is therefore not limited to any particular DNA sequence. For example, the DNA fragments or linear DNA fragments in the form of vectors and plasmids used in some cases contain only DNA elements expressed in plants. In certain embodiments, replication-competent viral vectors can be used for monocot transformation. Such vectors include wheat dwarf virus (WDV) "shuttle" vectors (eg, pW1-11 and PW1-GUS) (Ugaki et al., 1991). These vectors can replicate spontaneously in E. coli and corn cells, thus providing improved sensitivity for detecting DNA delivered to transgenic cells. Replication vectors are useful for the delivery of genes flanked by DNA sequences obtained from transposon elements such as Ac, Ds or Mu. The translocation of these elements in the maize genome is known to require DNA replication (Laufs et al., 1990). In addition, the transmissible element is expected to be useful for introducing elements necessary for the selection and maintenance of plasmid vectors in bacteria, such as DNA fragments lacking antibiotic resistance genes and DNA replication origins. In addition, transpositionable elements such as Ac, Ds or Mu are expected to actively promote the integration of the desired DNA, thus increasing the frequency of stably transformed cells. In addition, where co-transformation of a plant or plant cell with two or more vectors is necessary, co-transformation can be achieved using vectors bearing the mark and other genes of interest. Alternatively, different vectors, such as plasmids, may have different genes of interest and co-deliver to recipient cells. Using this method, it is assumed that some of the cells into which the mark has been introduced will absorb other genes of interest. Thus, not all cells selected by the mark express other genes of interest co-transmitted to the cells. Vectors, plasmids, cosmids, YACs (yeast artificial chromosomes), BACs (bacterial chromosomes), and other DNA segments used for transformation of plant cells generally contain cDNAs or genes desired to be introduced into the cells. These DNA constructs can include structures such as promoters, amplifiers, polylinks, or regulatory genes, if desired. DNA segments or genes selected for transduction often encode proteins that are expressed in the resulting recombinant cells and exhibit selectable or selectable properties or confer improved phenotypes to the regenerated plants. However, this is not always the case, and the invention also includes transgenic plants incorporating non-expressed exogenous genes. Suitable components that are likely to be included in the vector used in the present invention are as follows. (i) regulatory elements Constructs made in accordance with the present invention generally include a promoter that limits gene silencing in maize or other monocots. In such cases, the promoter may be isolated from species other than monocots that require exogenous gene expression. Suitable constructs generally include promoters obtained in Coix. Promoters can be isolated from Coix or from known genes or promoters based on data. Examples of known monocot genes and promoters that are expected to be particularly useful for isolation of promoters obtained from Coix have been described above. In addition to promoters, other types of elements can regulate gene expression. One such element is the DNA sequence between the transcription start position and the starting position of the coding sequence (untranslated read sequence). Read sequences can affect gene expression, where read sequences have been edited to predict optimal or sub-optimal sequences and produce "common" and appropriate read sequences (Joshi, 1987). Appropriate read sequences include read sequences having sequences that are expected to supervise optimal expression of the added gene, ie, suitable common read sequences that increase or maintain mRNA stability and prevent inappropriate translation initiation. Selection of such sequences is known in the art in light of this publication. Most preferred are sequences derived from genes that are highly expressed in plants. Transcription amplification agents or a plurality of amplification agents may be used to increase expression. These amplification agents are found at 5 'of the transcription start position on a promoter functioning in eukaryotic cells, but can be inserted 5' or 3 'in the coding sequence in the forward or backward direction. In some cases, these 5 'amplification elements are introns. Examples of amplifying agents include the CaMV 35S promoter, octopin synthase gene (Ellis et al., 1987), rice actin 1 gene, corn alcohol dehydrogenase gene, corn wrinkle 1 gene, non-plant eukaryotes (eg yeast) Promoter obtained from Ma et al., 1988). It is expected that vectors carrying ocs amplifying element will be used specifically in accordance with the present invention. This element was initially identified as a 16 bp parindom amplifier derived from the Agrobacterium octopin synthase (ocs) gene (Ellis et al., 1987) and is present on more than 10 promoters. Bouchez et al., 1989). Using amplification elements such as the ocs element and multiple copies of these elements is expected to increase the level of transcription of adjacent promoters subjected to monocotyl transformation. Introduction of large DNA sequences consisting of one or more genes is preferred. Such sequences can be facilitated by the use of bacterial or yeast artificial chromosomes (BACs or YACs, respectively), or plant artificial chromosomes. For example, the use of BAC for Agrobacterium-mediated transformation has been described by Hamilton et al. (1996). Ultimately, the most appropriate DNA segment for introduction into the monocot genome is a homologous gene or gene family that encodes the desired properties (e.g. increased yield per acre) and is introduced under the control of a novel promoter or amplifying agent according to the present invention. do. Tissue specific regulatory regions are particularly useful in this respect. Indeed, a particular use of the present invention is to produce transformants comprising foreign transgenes that are targeted in a tissue-specific manner. For example, insect resistance genes are specifically expressed in rotiferous and sheath tissues that are the targets of the first and second hatching of European grain perforated insects (ECBs). Similarly, genes encoding proteins that have specific activity for rootworms can allow direct targeting of root tissue. In addition, the expression of certain genes that affect the nutritional composition of the grain should target the seed, for example, milk or pear. Vectors used for tissue-specific targeting of gene expression in transgenic plants have a tissue-specific promoter and also include other tissue-specific regulatory elements such as amplifier sequences. Promoters driving specific or enhanced expression in certain plant tissues in accordance with the present invention are known to those of skill in the art in light of this publication. In addition, tissue specific expression can be functionally achieved by introducing a structurally expressed gene (all tissues) complexed with an antisense gene that is expressed only in tissues in which the gene product is undesirable. For example, genes encoding crystalline toxin proteins obtained from B. thuringiensis (Bt) are introduced and expressed in all tissues using structural promoters, such as actin promoters obtained from Coix. In addition, it is expected that promoters that combine elements obtained from one or more promoters will be useful. For example, U.S. Patent No. In 5,491,288 a combination of histone promoter and cauliflower mosaic virus promoter is shown. Expression of the antisense transcript of the Bt gene in the corn core using the zein promoter can prevent the accumulation of Bt protein in the seed. Thus, the protein encoded by the introduced gene is present in all tissues except the core. Alternatively, for use in accordance with the present invention, it is desirable to obtain novel tissue-specific promoter sequences obtained from Coix. To this end, cDNA clones are first isolated from the relevant tissues, and the clones specifically expressed in the tissues are identified using nozan blotting. Ideally, it is desirable to identify genes that have few copies, but whose gene products are relatively abundant in certain tissues. The promoters and regulatory elements of the corresponding genomic clones are then located using molecular biology techniques known to those skilled in the art. Another useful method for identifying tissue-specific promoters is the differentiation display (U.S. Patent No. 5,599,672). In the differentiation display, mRNA is compared with different tissue types. By identifying mRNA species present only in some specific tissue types or groups of tissue types, the corresponding genes expressed in a tissue specific manner can be identified. RNA is reverse transcribed with reverse transcriptase to produce cDNA, which is used to isolate clones carrying the full length gene. As specifically described in this article, cDNA can be used to isolate homologous or homologous promoters, amplifiers or transcriptional termination signals from each gene using inhibitory PCR. Expression of some genes in transgenic plants is expected to be desirable only under certain conditions. For example, the expression of certain genes that confer resistance to environmental stressors such as drought is desirable only under actual stress conditions. In addition, the expression of these genes during plant development is expected to have a deleterious effect. Many genes are known to respond to the environment. For example, the expression of some genes, such as rbcS encoding ribulose bisphosphate carboxylase, can be controlled by photochrome mediated light. Other genes can be induced by secondary stimulation. For example, the synthesis of absic acid (ABA) leads to certain environmental factors, including water stress. Many genes have been found to be induced by ABA (Skriver and Mundy, 1990). In addition, expression of genes that confer resistance to insect predation is desirable only under actual insect rampant conditions. Thus, for some desired properties, inducible expression of the gene in the transgenic plant is preferred. In an embodiment of the invention, the expression of the gene in the transgenic plant is desirable only at certain times during the development of the plant. Development time is primarily associated with tissue specific gene expression. For example, the expression of the Jane storage protein begins in the breast about 10 days after pollination. It is also expected that it would be useful to target intracellular DNA itself. For example, it is beneficial to have the introduced DNA target the nucleus because this increases the frequency of transformation. In the nucleus itself, it is beneficial to target genes to achieve site specific integration. For example, it is beneficial to have genes introduced through transformation in cells replace existing genes. (ii) transcription termination signal The construct generally retains the gene of interest along with the 3 ′ terminal DNA sequence that serves as a signal to terminate transcription and to enable polyadenylation of the resulting mRNA. The most suitable 3 'element is that obtained from Agrobacterium tumefaciens's nopalin synthase gene (3' terminus) (Bevan et al., 1983), of Agrobacterium tumefaciens. It is expected to be the transcription end signal of the T7 transcript from the octopine synthase gene and the 3 'end of the protease inhibitor I or II gene from potato or tomato. If desired, it may include regulatory elements such as Adh intron 1 (Callis et al., 1987), sucrose synthase intron (Vasil et al., 1989) or TMV omega elements (Gallie, et al., 1989). Alternatively, the transcription termination signal can be isolated according to the invention from Coix as described above for the promoter sequence. In particular, suitable terminators are Coix isolates from. For example, gamma coicin terminator and Coix oleosin 3 terminator. Examples 2 and 3 below describe the cloning of these terminators. For example, the sequences SEQ ID NO: 11 and SEQ ID NO: 17 show the nucleic acid sequences of each gamma coicin and oleosin 3 terminator. (iii) delivery and signal peptide The sequence that binds to the coding sequence of the resistance gene is removed after translation in the initial translation product and is the so-called transport that carries the protein through or to the intracellular or extracellular membrane (this is to fear, vesicles, plastids or other intracellular organs). Or signal sequences (usually to the outside of the reticular endothelial, Golgi apparatus, cell membrane). By transporting proteins into the inner compartment of the cell, such sequences protect against proteolysis, increasing the accumulation of these gene products. Such sequences also allow for the addition of mRNA sequences of highly expressed genes attached to the coding sequences of genes. Since the mRNA translated by ribosomes is more stable than the Naked mRNA, the presence of a decipherable mRNArk in front of this gene increases the overall stability of the mRNA transcript from the gene. Because the transport and signal sequences are typically removed after translation in the initial translation product, using these sequences allows the addition of extra translated sequences that do not appear in the final polypeptide. In addition, to increase the stability of the protein, it is necessary to carry the transport of specific proteins (US Pat. No. 5,545,818). In addition, vectors can be constructed and used in the case of intracellular targeting of specific gene products into cells of transformed plants or direct proteins to the extracellular environment. The DNA sequence encoding the transport or signal peptide sequence may be linked to the coding sequence of the specific gene. The resulting transport or signal may be removed after translation by transferring each protein to a specific intracellular or extracellular destination. Specific examples of such uses are directed to proteins that provide insecticide resistance, such as mutant EPSPS proteins, to specific organs such as chloroplasts other than the cytoplasm. For example, using rbcS transport peptides (which are chloroplast transport peptides described in US Pat. No. 5,728,925 or optimized transport peptides described in US Pat. No. 5,510,471), to provide a pigment-specific target protein. It is also possible to target specific genes that are resistant to male infertility to the mitochondria, to target genes that are resistant to plant-variable organisms in the extracellular space, or to target proteins in fear. Further uses may be directed to an enzyme involved in amino acid biosynthesis or oil biosynthesis in the plastid. Such enzymes include dihydrodipicolinic acid synthase, which increases the lysine content in the feed. (iv) target genes To improve the ability to identify transformants, selectable or screenable marker genes can be used in addition to the expressible gene of interest. A “marker gene” is a gene that provides a distinct phenotype to cells expressing a marker gene, so that such transformed cells can be distinguished from cells without a marker. Such genes may be used to examine or test (eg, "green fluorescent protein") whether the marker confers traits that can be delineated using chemical means, such as selective agents (eg, pesticides, antibiotics, etc.). Depending on whether the trait can be easily identified through the classification can be classified as a selectable or screenable marker. Of course, suitable marker genes for use in the present invention will be recognized by those skilled in the art. Selectable or screenable marker genes also include genes that encode "selectable markers" in which secretion is detected by means of identification or screening of transformed cells. Examples include markers that encode secretable antigens that can be identified by antibody interactions, or markers that encode secretable enzymes that can be detected by their catalytic activity. Secretory proteins include small diffuseable proteins detectable by ELISA; Small activity enzymes detectable in extracellular solution (eg, α-amylase, β-lactamase, phosphinothricin acetyltransferase); Proteins that are inserted or collected in the cell wall (eg, proteins containing leader sequences such as those found in expression units of extensin or tobacco PR-S). For selectable separable markers, it is particularly advantageous to include genes encoding proteins that can be sequestered in the cell wall, including unique epitopes in these proteins. Such secreted antigenic efficacy ideally utilizes low level epitope sequences in plant tissues, effective expression and targeted promoter-leader sequences that cross the plasma membrane to create proteins that can bind to the cell wall and access antibodies. . Normally secreted proteins that are modified to contain unique epitorses can meet this requirement. Suitable proteins to be modified in this way are extensin or hydroxyproline rich glycoproteins (HPRG). The use of maize HPRG (Steifel et al., 1990) is appropriate because of its well known molecular biology, expression and protein structure. However, one of the extensin and glycine rich wall proteins (Keller et al., 1989) can be modified to add antigenic sites to make screenable markers. One embodiment of a secretable screenable label is to use a corn sequence encoding a wall protein HPRG modified to include the 15 residue epitope of the pro portion of the murine interleukin1-β (IL-1-β). However, in practice, detectable epitopes can be used in such embodiments, and can be selected from a wide variety of antigen: antibody complexes known in the art. Unique extracellular epitopes derived from IL-1β or any other protein or epitope moiety can be detected immediately using antibody labeling in combination with chromogenic or fluorescent adjuvant. 1. Selectivity Marker Various selectable marker genes can be used in connection with the present invention, for example, the neo gene (Potrykus et al., 1985), which encodes kanamycin resistance and can be screened using kanamycin, G418, paramomycin and ; bar gene-gene confers bararafoss resistance; Mutant EPSP synthase protein (Hinchee et al., 1988) -genes conferring glyphosate resistance; Nitrile genes such as bxn of Klebsiella ozaenae—genes that confer resistance to bromineoxyl (Stalker et al., 1988); Mutant acetolactate synthase genes (ALS) that confer resistance to imidarroline, sulfonylureas or other ALS resistant chemicals (European Patent Application 154,204, 1985); Zetotrexate resistant DHFR gene (Thillet et al., 1988); And include, but are not limited to, the Dalapon dihalogenase gene that provides resistance to the insecticide Dalphon, or a mutated anthranide synthase gene that confers resistance to 5-methyl tryptophan. When using mutant EPSP synthase, appropriate chromosomal transport peptides; CTP (US Pat. No. 5,188,642); OTP (US Pat. No. 5,633,448); Additional benefits can be obtained by incorporating the EPSPS gene (PCT Application WO 97/04103). In selecting transformants, embodiments of selectable marker genes available in the system include genes encoding phosphinothricin acetyltransferase enzymes, such as the bar gene from Streptomyces hygroscopicus or the pat gene from Streptomyces viridochromogenes. It can be a gene. Phosinothricin acetyltransferase (PAT) inactivates the active ingredient in the insecticide bialaphos, phosphinothricin (PPT). PPT interferes with glutamine synthetase (Murakami et al., 1986; Twell et al., 1989), resulting in the rapid accumulation of ammonia, causing cell death. In practicing the present invention, in the case of using a non-Alphas resistance gene, the inventors have found that the gene which is particularly useful for this purpose is the bar gene or pat gene obtainable from Streptomyces (ATCC No. 21,705). Cloning of the bar gene is described in Murakame et al., 1986; As described in Thompson et al., 1987, it is equivalent to using the bar gene in plants (De Block et al., 1987; De Block et al., 1989; U.S. Patent No. 5,550,318). 2. Screenable Markers Screenable markers that can be used include the uidA gene (GUS), which encodes an enzyme known as β-glucuronidase or various chromosomal substrates; R-position gene (Dellaporta et al., 1988), which encodes a product that regulates the production of anthocyanin pigment (red color) in plant tissues; Β-lactamase gene (Sutcliffe, 1978), encoding enzymes known as various chromogen substrates (PADAC, chromogenic cephalosporin); XylE gene encoding catechol deoxygenase, which converts to chromosomal chacatechol (Zukowsky et al., 1983); α-amylase gene (Ikuta et al., 1990); Tyrosinase gene (Katz et al., 1983), which encodes an enzyme that oxidizes tyrosine to DOPA and dopaquinone and condenses it again to form the easily detectable compound melanin; Β-galactosidase gene encoding an enzyme known as a chromogen substrate; Luciferase (lux) gene capable of detecting bioluminescence (Ow et al., 1986); The Equirin gene, which can be used to detect calcium-sensitive bioluminescence (Prasher et al., 1985); Genes encoding green fluorescent proteins (Sheen et al., 1995; Haseloff et al., 1997; Reichel et al., 1996; Tian et al., 1997; WO 97/41228). The genes of the corn R gene complex can be seen as particularly useful as screenable markers. The R gene complex in maize encodes a protein that functions to regulate anthocyanin pigment production in most seed and plant tissues. Corn strains have one or up to four R alleles, which are combined to regulate pigment in a developmentally and tissue-specific manner. Therefore, the R gene introduced into such cells can express red pigments, and when they are stably bound, they can be visually recorded as red sectors. Transformation of any cell into R, if the corn strain has a dominant allele that encodes an enzyme intermediate (C2, A1, A2, Bz1, Bz2) of anthocyanin biosynthetic condensation and has a recessive allele at the R position In this case, a red pigment is formed. For example, Wisconsin 22, TR112, K55 derivatives having the rg-Stadler allele, such as r-g, b, P1 and the like. Alternatively, any genotype corn may be used in combination with the C1 and R alleles. The use of the R gene regulatory portion in chimeric constructs may provide a mechanism for regulating the expression of chimeric genes. It is known to have a wide variety of phenotypic expressions at the R position rather than at other positions (Coe et al., 1988). Regulatory moieties obtained at the 5 'end portion of the structural R gene may be beneficial for gene expression of insect resistance, insecticide resistance or other coding moieties. For the purposes of the present invention, any member of the various R gene families can be used successfully, for example, P, S, Lc and the like. However, most suitable is Sn (particularly Sn: bol3). Sn is a dominant member of the R gene complex, which functions similarly to the R and B positions, which regulate tissue-specific deposition of anthocyanin pigments in certain seedlings, plant cells, so that their phenotype is similar to R. A screenable effect that can be used in the present invention is firefly luciferase encoded by the lux gene. The presence of the lux gene in the transformed cells can be detected using an X-ray film, scintillation counter, fluorescence spectrophotometer, low light video camera, photon counting camera or multiwell luminometer. Such a system can be developed for collective screening for bioluminescence in tissue culture plates or whole plant screening. Genes encoding green fluorescent proteins are seen as particularly useful reporters (Sheen et al., 1995; Haseloff et al., 1997; Reichel et al., 1996; Tian et al., 1997; WO 97/41228). Expression of the green fluorescent protein can be seen as fluorescence in cells or plants after irradiation with light of a specific wavelength. (v) Foreign introduction genes for modification of monocots A particularly important advance in the present invention is the provision of methods and compositions for the efficient expression of genes in plant cells in addition to or in addition to marker genes. Such exogenous genes may be transposons that express particular proteins or polypeptide products but which are non-expressed DNA fragments such as Ds that are not involved in their translocation. As used herein, a “expressable gene” is any gene that is transcribed into RNA (eg, mRNA, antisense RNA) or translated into a protein and expresses a trait of interest, but are selectable, screenable or non- It is not limited to selectable marker genes. In addition, the present invention may combine expressable genes that do not require a marker gene with the marker gene to use separate genes on the same or different DNA fragments for transformation. In the latter case another vector is simultaneously delivered to the recipient cell, maximizing co-transformation. The particular DNA fragment to be delivered to the recipient cell depends on the purpose of the transformation. One of the main purposes of grain transformation is to add commercially useful agriculturally important traits to plants. Such traits include insecticide resistance or resistance; Insect resistance or resistance; Disease resistance or resistance (viruses, bacteria, gompies, nematodes); Stress resistant or resistant, for example, drought, heat, frostbite, freezing, excessive moisture, salt, etc .; Oxidative stress; dry; Uprightness; Fertility; Quantity and quality of starch; Quantity and quality of oils; Quantity and quality of protein; Compositions such as, but not limited to, amino acids. One or more genes conferring such desirable trait (s) may be combined, such as genes encoding insecticide resistance. In certain embodiments, the invention contemplates transforming one or more exogenous genes into recipient cells. As used herein, an "exogenous gene" refers to a gene that is identical and is not normally found in the host genome. It means that one or more regulatory moieties that are isolated from species other than the host genome or from the host genome, but which are different from those expressed in an unmodified interacting gene. Two or more exogenous genes can be supplied in one transformation using separate exogenous gene encoding vectors or using one vector with two or more gene coding sequences combined. For example, plasmids with bar and aroA expression units in the astringent, divergent or colinear direction are preferred. In addition, a gene such as a Bt insect resistance gene and a protease inhibitor gene such as pinII or a bar gene may be combined with the gene. Of course, any two or more foreign genes, such as insecticides, insects, diseases (viral, bacterial, fungal, nematode) or drought resistant, male sterile, dry, upright, fertility, starch properties, oil quantity and quality, or Introduced genes associated with increased yield or nutrient quality may be used. 1. Insecticide Resistance Phosphinothricin acetyltransferase (bar and pat), glycolide resistant EPSP synthase gene, glyphosate degrading enzyme gene encoding glyphosate oxidoreductase gox, deh (dihalogenase enzyme that inactivates dalapon) Encoded); Insecticide resistance genes (sulfonylurea and imidazolinone), acetyllactate synthase, bxn gene (encoding nitriase enzymes that break bromooxynyl), etc. that can be used for transformation Is a good example. The bar and pat genes encoding phosphinothricin acetyltransferase (PAT) enzymes can inactivate the insecticide phosphinothricin and protect it from compounds that inhibit glutamine synthase. The enzyme 5-enolpyrubilishkimate 3-phosphophosphate synthase (EPSP synthase) is normally inhibited by the insecticide N- (phosphonomethyl) glycine (glyphosphate). However, genes are known to encode glyphosate-resistant EPSP synthase. Such genes are particularly useful for monocot transformation. The deh gene encodes the Dalapon dehalogenase enzyme, conferring resistance to the insecticide Dalapon. The bxn gene, which encodes a specific nitriase enzyme, encodes an enzyme that converts bromooxynyl into a product that does not degrade to pesticides. 2. insect resistance Potential insect resistance genes that may be introduced are the Bacillus thuringiensis crystalline toxin gene or the Bt gene (Watrud et al., 1985). The Bt gene provides resistance to repidothean or choleptteran pests such as the European Corn Borer (ECB). Suitable Bt toxin genes that can be used in such embodiments include the CryIA (b) and CryIA (c) genes. Endotoxin genes from other species of B. thuringiensis that may affect the growth or development of pests may also be used. Appropriate Bt genes that can be used in the transformation processes described herein appear to be effective in modifying their coding sequences, thereby increasing expression in plants, particularly maize. Methods of preparing synthetic genes are known in the art and are described, for example, in US Pat. Nos. 5,500,365 and 5,689,052. Examples of such modified Bt toxin genes include the synthetic Bt CryIA (b) gene (Perlak et al., 1991) and the synthetic CryIA (c) gene (1800b) (PCT Application WO 95/06128). Some examples of other Bt toxin genes known to are shown in Table 3 below. Table 3a Table 3b Table 3c http://epunix.biols.susx.ac.uk/Home/Neil_Crickmore/Bt/index.html Protease inhibitors provide insect resistance (Johnson et al., 1989) and are useful for plant transformation. The protease inhibitor II gene pinII obtained from tomatoes or potatoes appears to be particularly useful. More advantageously, the combination of the pin II gene and the Bt toxin gene is used, and the combined effect of these compounds has been found to provide synergistic effects on insecticidal activity. Genes that encode inhibitors of the insect digestive system or that encode enzymes or identifiers that produce the inhibitors are useful. Such populations become orysisstatin and amylase inhibitors such as those found in wheat and barley. In addition, genes encoding lectins impart additional or other pesticidal properties. Lectin (originally called phytohemagglutinin) is a multivalent carbohydrate binding protein that has the ability to aggregate red blood cells of various species. Lectins have recently been identified as insecticides active against weevil, ECB, and rootworms (Murdock et al., 1990; Czapla & Lang, 1990). The lectin genes considered useful are the lectins of barley and malt aglutinin (WGA) and rice (Gatehouse et al., 1984), with WGA being most appropriate. When introduced into pests, another aspect of the invention is a gene that can resist insects and regulate the production of large or small polypeptides such as cell soluble peptides, peptide hormones and toxins and toxins. For example, the expression of adolescent hormone esterases against certain pests results in pesticidal activity and the transformation is stopped (Hammock et al., 1990). Transformed corn expressing a gene encoding an enzyme that affects the integrity of the insect epidermis is another aspect of the present invention. Such genes include the introduction of genes that produce chitinase, protease, lipase and nicomycin, compounds that inhibit chitin synthesis, and any genes that appear to produce corn plants resistant to insects. Genes that encode activity that affects the molting of insects, such as genes that affect the production of ecsteroids UDP-glucosyl transferase, are also within the scope of the present invention. Genes encoding enzymes that produce compounds that reduce host plant influence on pests are also within the scope of the present invention. For example, sterol composition can be modified to increase pesticidal activity in plants. Sterols are obtained from insect food and are used for hormone synthesis and membrane stability. Thus, by modifying a plant's sterol composition by expressing a novel gene, i.e., a gene that directly promotes the production of unwanted sterols or converts the desired sterols into an unwanted form, the plant is provided with a negative effect on insect growth and development. To have pesticidal activity. Lipoxygenase is a naturally occurring plant enzyme that exerts an anti-nutritive effect on insects, which appears to reduce the quality of the nutrients of insects. Accordingly, embodiments of the invention relate to transformed plants that enhance lipoxygenase activity that is resistant to insect feed. Tripsacum dactyloides is a type of grass that is resistant to certain pests, particularly grain root pests. Genes encoding proteins that are toxic to pests or genes that encode proteins involved in biosynthesis of compounds toxic to pests may be isolated from Tripsacum, such a novel gene may be useful for imparting resistance to pests. Total resistance to Tripsacum is based on heredity, as this resistance is transmitted to Zea mays through sexual mating (Branson and Guss, 1972). In addition, other grain monocotyledonous or dicotyledonous plant species have genes encoding proteins that are poisonous to pests, which is useful for producing crop plants that are resistant to pests. Genes encoding proteins characterized by having pesticidal activity can be used as foreign introduction genes. Such genes include eastern trypsin inhibitors (CpTI; Hilder et al., 1987) that can be used as root pest inhibitors; Genes encoding avermectins that have proven to be particularly useful as grain root pest inhibitors (Avermectin and Abamectin., Campbell, W.C., Ed., 1989; Ikeda et al., 1987); Ribosomal inactivating protein genes; Genes that regulate plant structure are included. Transformed maize including anti-insect antibody genes and genes encoding non-toxic insecticides (pre-pesticides) on the outside of the plant to encode enzymes that can be converted into toxic pesticides inside the plant. Can be considered 3. Environmental or stress resistant Through the expression of new genes, grains can be improved to tolerate a variety of environmental stresses, including but not limited to drought, excessive moisture, frostbite, freezing, high temperatures, salts, and oxidative stress. By introducing "antifreeze" proteins or synthetic genes derived therefrom, such as those described by Winter Flounder (Cutler et al., 1989), the advantages of increasing resistance to freezing temperatures can be realized. Increasing the expression of glycerol-3-phosphate acetyltransferase in chloroplasts increases resistance to frostbite (Wolter et al., 1992) Resistance to oxidative stress (high temperature conditions with strong light) Can be provided by the expression of superoxide dismutase (Gupta et al., 1993) and can be improved by glutathione reductase (Bowler et al., 1992). Can be used to extend venom stunts with higher yields in earlier maturation zones. By expressing new genes that favorably affect the moisture content of the plant, the total potential moisture, osmotic pressure, and swelling, it is possible to mislead the plant's ability to tolerate drought. As mentioned herein, "drought resistance" and "drought tolerance" increase resistance or resistance to stress induced by reduced water availability when compared to normal environments, and allow plants to survive and function in low water environments. Have the ability to do it. In one aspect of the invention, the expression of a gene encoding biosynthesis of a solute such as a polyol compound having an osmotic pressure will protect against drought. Within this range, there are genes encoding mannitol-L-phosphate dehydrogenase (Lee and Saier, 1982) and trehalose-6-phosphate synthase (Kaasen et al., 1992). Due to the genes thus introduced by the continuous action of intrinsic phosphatase or by the introduction and co-expression of specific phosphatase in cells, mannitol and trehalose accumulate, respectively, which are known as protective compounds that mitigate the effects of stress. have. The accumulation of mannitol in transgenic tobacco has been demonstrated, and its main results indicate that plants that express high levels of these metabolites are resistant to osmotic stress provided (Tarczynski et al., 1992, 1993). . Similarly, there is a record of the effects of other metabolites in protecting the function of an enzyme (eg alanofine or propionic acid) or the integrity of a membrane (eg alanofine) (Loomis et al., 1989), and thus Expression of genes encoding biosynthesis of the same compound may confer resistance to drought in a manner complementary or similar to mannitol. Other examples of naturally occurring metabolites that are osmotically active or provide some direct protective effects during drought or drying are furactose, erythritol (Coxson et al., 1992), sorbitol, and dulcitol (Karsten et al., 1992), glucosylglycerol (Reed et al., 1984; Erd Mann et al., 1992), sucrose, starkiose (Koster and Leopold, 1988; Blackman et al., 1992), Bernal-Lugo and Leopold , 1992), proline (Rensburg et al., 1993), glycine betaine, onnitol and finitol (Vernon and Bohnert, 1992). During stress, the growth and regeneration of the canal can be continuously increased by introducing and expressing the osmoactively active compounds mentioned above and genes such as those regulating such compounds. Currently suitable genes for promoting the synthesis of osmoticly active polyol compounds include enzymes such as mannitol-1-phosphate dehydrogenase, trehalose-6-phosphate synthetase and mininoositol O-methyltransferase. To encode. The expression of certain proteins can increase resistance to drought. Three types of late embryonic proteins were classified by their structural similarities (Dure et al., 1989). Three types of LEAs have been described as maturing seeds. In these three types of LEA proteins, Type-II (dehydrin-type) is generally associated with resistance to drought or drying in plant vegetation (ie Mundy and Chua, 1988; Piatkowski et al., 1990; Yamaguchi Shinozaki et al., 1992). Recently, the expression of Type-III LEA (HVA-1) in tobacco has been shown to affect plant height, maturity, and resistance to drought (Fitzpatrick, 1993). In rice, the expression of the HVA-1 gene affected water deficiency or salt tolerance (Xu et al., 1996). Expression of structural genes from three LEAs is resistant to drought. Other types of proteins induced during water stress include thiol proteases, aldorases and transmembrane and transpoters (Guerrero et al., 1990), which provide a variety of protective and repair functions during drought stress. Grant. Genes that affect lipid biosynthesis and membrane composition are useful for conferring drought resistance in plants. Many of these genes that improve drought resistance have complementary modes of action. Thus, combining such genes may have additional or synergistic effects in improving drought resistance in maize. Many of these genes improve resistance (or resistance) to freezing, and the physical stresses that occur during freezing and drought are similar in nature and can be alleviated in a similar manner. Structural expression of such genes may provide benefits, where appropriate means of expressing such novel genes are provided by promoters induced by swelling (eg, Guerrero et al., 1990 and Shagan et al., 1993). Promoters for genes induced by swelling as described in. The spatial and temporal expression of these genes makes grains more resistant to stress. It is also beneficial to express genes associated with certain morphological traits that lead to increased water extract by drying the soil. For example, introduction and expression of genes that modify root characteristics can enhance water uptake. It is also valuable to express genes that enhance regeneration during stress. For example, it is also beneficial to express genes that improve concurrency of pollen flow and water solubility, such as whiskers, of female flower parts. In addition, expressing a gene that minimizes grain stoppage during stress increases the grain to harvest and is valuable. Considering the overall role of water in determining production, introducing and expressing new genes in maize effectively improves the availability of water and improves the overall function even when the water availability of the soil is not limited. It is possible for corn to introduce genes that can maximize water use for the full range of stresses in relation to water availability, production stability or continuity of production. 4. Disease Resistance It is suggested that genes can be introduced into monocotyledonous plants, such as maize, to increase resistance to disease. It can make you resistant to diseases caused by viruses, bacteria, fungi and nematodes. This means that it is possible to regulate the organisms producing mycotoxins through the expression of the introduced genes. Expression of new genes can make the virus resistant. For example, viral coated proteins are expressed in transformed plants to confer resistance to plant infection by viruses and other related viruses (Cuozzo et al., 1988, Hemenway et al., 1988, Abel et al. , 1986). Antisense genes that are targeted by essential viral functions are expressed and confer resistance to the virus. For example, the antisense gene targeted in the gene responsible for the replication of viral nucleic acid inhibits replication and induces resistance to the virus. Antisense genes are used to increase interference with other viral functions, increasing resistance to viruses. It is also possible to have resistance to viruses through other methods, such as but not limited to satellite viruses. According to the present invention, viruses and virus-like diseases that may have resistance in transformed plants are illustrated in Table 4. Table 4a Table 4b Through the introduction of new genes, resistance to diseases caused by bacteria and fungi can be increased. As a morphological feature, genes encoding "peptide antibiotics", etiology related (PR) proteins, toxin resistance, proteins that affect host pathogen interactions appear to be useful. Peptide antibiotics are polypeptide sequences that inhibit the growth of bacteria and other microbes. For example, peptide species such as ceropins and mahainins inhibit the growth of many types of bacteria and fungi. Expression of PR proteins in monocotyledonous plants, such as maize, may render them resistant to bacterial diseases. Such genes can be introduced into a host plant following a pathogen attack, which can be classified into at least five types of proteins (Bol, Linthorst, and Cornelissen, 1990). PR proteins include β-1,3-glucanase, chitinase, osmotin, and other proteins that appear to be resistant to plants in diseased organisms. Other genes with antifungal properties have also been identified, such as stinging nettle lectin (UDA) and hevein (Broakaert et al., 1989; Barkai-Golan et al., 1978). Certain plant diseases cause phytotoxic production. Resistance to such diseases can be achieved by expressing new genes encoding enzymes that can degrade or inactivate phytotoxic. Expression of new genes that alter the interaction between host plants and pathogens reduces the ability of disease organisms to penetrate into host plant tissues, for example, to increase the oxicity of leaf epidermis or other morphological features. Increase. Examples of bacterial fungal diseases, including fungal diseases that can induce resistance to plants transformed according to the present invention, are shown in Tables 5, 6, and 7 below. Table 5 Table 6 Table 7a Table 7b Table 7c Table 7d In many plants, including corn, plant parasitic nematodes cause disease. The expression of novel genes can make cereal plants resistant to these organisms. Nematodes may control the prevalence of nematode diseases by altering their ability to recognize or attach to host plants or by allowing plants to produce compounds that can kill nematodes, such as proteins. Diseases associated with nematodes that can introduce resistance in plants transformed according to the present invention are shown in Table 8 below. Table 8 5. Mycotoxin Reduction / Removal The production of mycotoxins, including aflatoxins and humonicins, due to fungi associated with monocotyledonous plants, such as corn, is a major factor making grains useless. Such fungal organisms do not interfere with plant growth or cause diseases that interfere with growth, but they produce chemicals (fungal poisons) that are poisonous to animals. Inhibiting the growth of such fungi reduces the synthesis of such toxins and thus reduces the loss of grain due to mycotoxin contamination. In addition, new genes may be introduced into monocotyledonous plants such as corn so as to inhibit the production of mycotoxins without interfering with the growth of fungi. In addition, expression of a novel gene encoding an enzyme that can prevent fungal poisoning from toxicity would reduce the fungal poisoning of the grain. Any of the above mechanisms can reduce mycotoxins in grains. 6. Grain composition and quality Genes can be introduced into commercially important grains, such as monocotyledons, particularly corn, to improve grain by growing the grain. The range of novel transformed plants produced in this way depends on the specific purpose of the grain. The largest use of corn is feed and food. Introducing genes that modify the composition of the grain can significantly improve the value of the grain or feed. The main components of corn grains are starch, protein and oil. Each of these major components of maize can be improved by varying levels and compositions. Some examples are given, but they do not provide an extensive list of possible ones. The grain kernel protein, including corn, is unsuitable for feed and food when fed to pigs, poultry and humans. Some of the amino acids that are essential to the food of these species are missing and require supplementation to be added to the grain. Restricted amino acids include lysine, methionine, tryptophan, threonine, valine, arginine, histidine and the like. Some amino acids may be restricted even after adding others to the food composition. For example, when soy is supplemented to meet lysine needs in grain, methionine is limited. The levels of these essential amino acids in seeds and grains are driven by mechanisms that increase the biosynthesis of amino acids, reduce the breakdown of amino acids, increase amino acid storage in proteins, or introduce genes that increase the transport of amino acids in seeds or grains. It can be raised, but not limited to such mechanism. One mechanism that increases the biosynthesis of amino acids is the introduction of genes that downregulate the biosynthetic condensation of amino acids, so that the level at which the plant is to be produced is no longer needed to be adjusted properly. This is done by avoiding or avoiding confinement in amino acid biosynthetic pathways that are normally regulated by the level of amino acid products of the pathway. For example, it encodes an uncontrolled state of asparatokinase or dihydrodipicolinic acid (DHDP) -synthesis to increase lysine and threonine production and anthranilate synthase to increase tryptophan production. Gene introduction is an example. To reduce amino acid catabolism is to introduce a DNA sequence that reduces or eliminates the expression of a gene encoding an enzyme that catalyzes a step in this pathway, such as the enzyme lysine-ketoglutarate reductase. It is desirable to target gene expression related to amino acid biosynthesis to the embryo or shoot of seeds. Genes encoding proteins related to amino acid biosynthesis that target proteins to the plastids using the plastid transport peptide sequences would be preferred. By altering the protein composition of the grain, it raises the expression of the native protein, reduces the expression of the protein with poor composition, changes the composition of the native protein or introduces a gene encoding an entirely new protein with a good composition. The balance of amino acids can be improved in a variety of ways, including by. For example, the introduction of DNA to reduce the expression of several storage proteins of the Jane family. Such DNA may encode a ribozyme or antisense sequence that impairs expression of the zein protein or impairs expression of zein expression modulators such as the opaque-2 gene product. In addition, the grain protein composition may be modified through co-inhibition, for example, to inhibit the expression of endogenous genes through expression of the same structural gene or gene fragment introduced through transformation (Goring et al. , 1991). The introduced DNA can also encode an enzyme that degrades zein. Increasing the protein with more preferred amino acid compositions or increasing other key seed constituents, such as starch, can reduce zein expression. Alternatively, a chimeric gene consisting of one of the globulin proteins or a suitable amino acid composition such as 10 kD delta zein, 20 kD delta zein or 27 kD gamma zein of maize, consists of the coding sequence of the native protein and a promoter or other regulatory sequence designed to elevate the expression of the protein. Can be introduced. Coding sequences of such genes may include addition or substitution codons for essential amino acids. Partially or wholly synthesized sequences that encode fully specific peptide sequences designed to enhance the amino acid composition of the coding sequence or seed obtained from other species can be used. It is desirable to target expression of such foreign transgenes encoding a protein having an excellent composition in seed's breast milk. Introducing a gene that changes corn oil content is also worth dLT. Increasing the oil content increases the density and metabolizable-energy content of seeds available for food and feed. The introduced gene may encode an enzyme that eliminates or reduces the rate-regulated or regulated step in fatty acid or lipid biosynthesis. Such genes include, but are not limited to, encoding acetyl-CoA carboxylase, ACP-acetyltransferase, β-ketoacyl-ACP synthase and other known fatty acid biosynthetic activities. Another possibility is genes encoding proteins that do not possess enzymatic activity, such as acyl transport proteins. Genes that change the balance of fatty acids in oils can be introduced to provide healthier or more nutritious feeds. The introduced DNA can encode a sequence that blocks the expression of enzymes involved in fatty acid biosynthesis to alter the proportion of fatty acids in the grains described below. Other examples of specific genes that the inventors may use to make transformed plants with altered oil composition traits include 2-acetyltransferase, oleosin, pyruvate dehydrogenase complex, acetyl CoA synthase, ATP istay Lyase, ADP-glucose pyrophosphorylase, carnitine-CoA-acetyl-CoA shuttle gene, and the like. The chromatin transport peptide sequences are used to target the expression of genes involved in oil biosynthesis, preferably to be expressed in seed germs. By increasing the degree of branching, delaying starch metabolism in cattle can improve the availability of starch, thereby introducing genes that enhance the nutritional value of starch components in the grain. Genes involved in starch biosynthesis can be expressed in the embryos of seeds. In addition to affecting the key constituents of the grain, genes may be introduced that can affect the diversity of other nutrients or other quality aspects of the grain available as food or feed. For example, the pigment of the grain may be increased or decreased. In some animal feeds, it may be desirable to enhance or stabilize the yellow pigment and introduce a gene that can enhance the production of santophyll and carotene by eliminating the rate-limiting step of pigment production. Such genes may encode other forms of phytoene synthase, phytoene desaturase, and lycopene synthase. Alternatively, white grains without pigments are preferable for producing many foods, and DNA may be introduced to block or remove the nucleus production pathway. Most of the phosphate content of the grain is phytate, which is a phosphate storage type that is not metabolized in animals with one stomach. Therefore, to increase the availability of seed phosphate, it is desirable to reduce the amount of phytate in the seed and increase the amount of free phosphate. Alternatively, the grain seed may be activated by pH in the gastric acid system of one gastrointestinal animal to express a gene that releases phosphate from phytate. Foods or feeds consisting primarily of corn or other grains do not contain sufficient vitamins and therefore must be replenished to provide adequate nutrition. Seeds can be planned to introduce genes that enhance the biosynthesis of vitamins A, E, B 12 and choline vitamins. Corn grains do not have enough minerals of adequate nutrition. Genes that affect the accumulation or availability of compounds including phosphoric acid, sulfur, calcium, manganese, zinc and iron are valuable. Genes that reduce phytic acid production or genes encoding enzyme phytase that enhance phytic acid degradation can be introduced. Such genes increase the levels of phosphate available in foods and reduce the need to supplement mineral phosphate. Several other examples of improving corn or other grains for food or feed may also be described. Improvements are not limited to grain, but can also improve the usefulness of pasture grain. This can be done by introducing DNA that exhibits a "brown leaf vein" phenotype that relates to good feed in cattle, including sequences that will alter lignin production. In addition to directly improving the value of food or feed, genes may be introduced that improve the processing of grain and improve the value of the product due to processing. The main method of processing grain is wet milling. Maize can be improved through the expression of new genes that reduce the effectiveness and cost of processing, such as reducing soaking time. Improving the value of wet mill products includes changing the quantity and quality of starch, oil, grain gluten or grain gluten feed. Starch can be raised by increasing the proportion of starch by identifying and removing the rate limiting step in starch biosynthesis or by reducing the level of other components in the grain. An example of the former is the introduction of a gene encoding a modified ADP-glucose pyrophosphorylase enzyme or a gene expressed at higher levels. Examples of the latter may include selective inhibitors of protein or oil biosynthesis expressed during the later stages of grain development. The properties of the starch can be beneficially modified by changing the ratio of amylopectin to amylose, changing the size of the starch molecules or changing their branching pattern. Such broad properties can modify such properties as, but not limited to, gelatinization temperature, heat provided for gelatinization, transparency of films and dough, fluidity, and the like. In order to modify the properties, the genes encoding particulate-binding or soluble starch synthase activity or branching enzyme activity alone or in combination are introduced. DNA, such as antisense constructs, can be used to reduce the endogenous activity levels of these enzymes. The introduced gene or construct may carry regulatory sequences that regulate the time expressed at certain intervals in starch biosynthesis and starch particulate development. It is also valuable to introduce and express genes that will bring in vivo induction or other modification of the glucose portion of the starch molecule. Covalent attachment of any molecule can be planned, as long as there is an enzyme catalyzing the accessibility and inducibility of the appropriate substrate in the starch granules. Examples of important inductions include the addition of functional groups, such as amine, carboxyl or phosphate groups, which affect the properties of the starch through the introduction of ionic charges or provide in vitro derivatization sites. Other modifications include direct changes to glucose, such as the loss of hydroxyl groups, or changes such as oxidation to aldehyde or carboxyl groups. Oil is another product of the wet milling of grain, and their value can be improved by the introduction and expression of genes. The amount of oil extracted with the wet mill may be raised in the same manner as in the food and feed described above. Modification of oil properties can improve their behavior in production, can be used for cooking oils, shortenings, lubricants or other oil-derived products, and can improve their contribution to health when used in food-related fields. . Upon extraction, new fatty acids can be synthesized and act as starting materials for chemical synthesis. Changing the type, level or arrangement of lipids in the oil can change the oil properties. In addition, the addition of genes encoding enzymes capable of catalyzing the synthesis of new fatty acids, the addition of lipids with them, or increasing the levels of native fatty acids while reducing the level of precursors as much as possible. Alternatively, introducing a sequence that delays or blocks the fatty acid biosynthesis step increases the precursor fatty acid intermediate. Genes to be added include desaturase, epoxidase, hydratase, dehydratase and other enzymes that catalyze reactions involving fatty acid intermediates. The tactile step to be blocked is typically to increase the accumulation of stearic and oleic acid by desaturation of stearic acid to oleic acid and unsaturation of oleic acid to linoleic acid. Another example is to block the extension step to accumulate C 8 to C 12 saturated fatty acids. Introduction of the gene to obtain new grain plants can improve other major grain wet meal products, grain gluten meal and grain gluten feed. Representative possibilities include, but are not limited to, those described above to improve the value of food and feed. It is also contemplated that grain plants used in the production or manufacture of useful biological compounds that are not produced at all or at the same level in existing grains. New grains producing such compounds can be obtained by introducing and expressing genes using a grain transformation method. Possible arrangements include, but are not limited to, any biological compound currently produced by any organism, such as proteins, nucleic acids, primary and intermediate metabolites, carbohydrate polymers. Compounds can be produced by plants, extracted at harvest or processing, and used for any currently recognized useful purpose such as pharmaceuticals, flavorings, and industrial enzymes. The nature of the grain or range of traits that can be encoded by the genes introduced in the transformed plants can be achieved by introducing genes that enhance γ-zein synthesis, resulting in export or larger particle sizes when processed by dry milling. Introducing genes that effectively block the expression of enzymes involved in improving the quality of popcorn, pigment production pathways, and alcoholic beverages, with improved degradation properties and swelling volume, through genes that increase the risk of degradation and susceptibility to grain degradation. Grains with white grain for use in food, candy corn, such as the Schrunken 1 gene (encoded with sucrose synthase) or the Schrunken 2 gene (encoded with ADPG pyrophosphorylase) State includes candy corn which introduced gene. 7. Agricultural features of plants Two of the factors that determine when to grow grain are the average day's temperature and the time to frost during the growing season. In areas where crops can grow, there are various restriction enzymes at the maximum time that they can mature and harvest. Grains that grow in a particular area are selected by their ability to mature in the time required for maximum production and to be dried to a harvestable moisture content. Therefore, grains with varying degrees of maturity at different growth sites have been developed. Apart from the need to be dry enough to harvest, it is desirable to dry to the maximum in the field to minimize the amount of energy required for further drying after harvest. The more suitable the grain is dried, the more time is used to grow and fill the grain. Identify genes that affect maturity and drying and introduce them into grain strains using transformation techniques to adapt yields to different growth sites or the same growth sites, but with improved yield relative to the percentage of moisture at harvest You can make new grain variants. Genes involved in regulating plant development are beneficial, for example, to express genes such as the Rigulureris and coarse leafy genes identified in grain. It is conceivable to introduce into the monocotyledonous genes which are improved by granulation and other plant growth characteristics. Expressing stronger genes, improved root systems, or new genes that can prevent or reduce the fall of ears is of great value to farmers. It is beneficial to introduce and express genes that increase the overall photostability availability by increasing the distribution and blocking of light. In addition, expressing a gene that increases the efficiency of photosynthesis and a gene that increases the efficiency of the leaf canal may increase grain productivity. Phytochrome gene expression may be beneficial in grain. Expression of such genes can reduce apical dominance, impart anti-dwarfism to plants, and increase shade tolerance (U.S. Patent No. 5,268,526). Such methods can increase plant populations in fields. Delaying vegetative aging at the end of the season increases the rate of assimilation into the grain, thus increasing the yield. It is beneficial to overexpress any gene in the grain that is associated with "keep green" or that delays aging. For example, mutations that do not turn yellow have been identified in Festuca pratensis (Davies et al., 1990). By expressing such genes and other genes, premature degradation of chlorophyll can be prevented to maintain crown function. 8. Nutritional Use The ability to use available nutrients is a limiting factor in the growth of monocotyledonous plants such as corn. By introducing new genes, it is possible to alter nutrient uptake, extreme pH resistance, and to change the availability of distribution, storage and metabolic activity throughout plants. This change allows the use of nutrients that are more efficiently available to plants such as corn. For example, increasing the activity of enzymes currently present in plants normally associated with the use of nutrients will increase nutrient availability. It is also desirable to increase nitrogen availability by grain plants. Expression of glutamate dehydrogenase in corn, such as the gdhA gene of E. coli, increases nitrogen fixation in organic compounds. In addition, gene expression of gdhA in grains results in excess ammonia binding to glutamate, thereby removing the poison of ammonia, thereby enhancing resistance to the insecticide glufosinate. More complex molecules can be considered to express new genes that make available previously inaccessible nutrients such as enzymes that release valuable components from macromolecules. 9. Male Infertility In producing hybrid seeds, male infertility is useful. By expressing a new gene, male infertility can be made. For example, it has been confirmed that expression of a gene encoding a protein that interferes with male flowering and matogenesis can render males infertile. Chimeric ribonuclease genes expressed in transgenic tobacco and rapeseed rice were used to induce male infertility (Mariani et al., 1990). Several mutations have been developed in corn that provide for male sterility in the cytoplasm. One mutation, called T-cytoplasm, is associated with susceptibility to southern grain blight. DNA sequences saved by TURF-13 (Levings, 1990) have been shown to be associated with T-cytoplasm. By introducing TURF-13 through transformation, it is possible to separate male infertility from disease susceptibility. When it is necessary to restore male fertility for breeding and grain production, a gene for restoring male fertility can be introduced. 10. Negative Selectable Markers Genes encoding selectable traits can be introduced to remove unwanted linked genes. When two or more genes are introduced by cotransformation, the genes will be linked together in the host's chromosome. Genes encoding the Bt gene that confer resistance to insects in plants are useful as selectivity markers . It can be introduced into plants with the bar gene, which confers resistance to. Insecticide Liberty It is not desirable to make insect resistant plants that are resistant to. Antisense bar genes expressed in tissues that do not wish to express bar genes in whole plant parts can be introduced. The bar gene can be expressed and used as a selectable marker, but not for imparting pesticide resistance to the entire plant. bar antisense genes is a negative selectivity marker. Negative selection may be required to screen for a population of transformants of good homologous recombination generated through gene targeting. For example, homologous recombination can be confirmed through inactivation of genes previously expressed in cells. Antisense genes for neomycin phosphotransferase II (NPT II) have been investigated as negative selectivity markers in tobacco (Nicotiana tabacum) and Arabidopsis thaliana (Xiang. And Guerra, 1993). For example, the sense and antisense NPT II genes are introduced into plants by transformation, and the resulting plants are sensitive to the antibiotic kanamycin. The introduced gene, which is bound at the antisense NPT II gene site to the host cell chromosome, inactivates the antisense gene, renders the plant resistant to kanamycin and other aminoglycoside antibiotics. Thus, rare site-specific recombination can be identified by screening for antibiotic resistance. Similarly, any gene that is native to the plant or introduced by transformation that confers resistance to the compound when inactivated can be used as a negative selectivity marker. Negative selectivity markers may also be used in other ways. One application part constructs a transformed strain, where an unlinked site can be selected for translocation. In the tagging process, it is common to move movable elements to genetically linked sites on the same chromosome. It can be used as a selectivity marker to recover rare plants that have been displaced into unlinked positions. For example, the target cytosine deaminase can be used for this purpose (Stouggard, 1993). In the presence of such an enzyme, compound 5-floorcytosine is converted to 5-fluorouracil, which is toxic to plant and animal cells. If the transcribable element is linked to a gene for the enzyme cytosine deaminase, the resulting plant can be screened for translocation to the unlinked site by selecting a translocation process in which 5-floorcitosine is resistant. Prototypes with paternal plants and dislocations at connected sites are still sensitive to 5-floorcitocin. Resistance to 5-floorcytosine is due to the loss of the cytosine diaminase gene through the genetic separation of the displaceable element and cytosine diaminase gene. Other genes that encode proteins that give plants susceptibility to certain compounds are also useful. For example, the T-DNA gene 2 of Agrobacterium tumefaciens encodes a protein that catalyzes the conversion of α-naphthylene acetamide (NAM) to α-naphthalene acetic acid (NAA), making plants susceptible to high levels of NAM. (Depicker et al., 1988). Negative selectivity markers are useful for constructing transposon tag lines. For example, negatively selectable markers of autogenous transcribable elements such as Ac, Master Mu, En / Spn can be used to select transformants in which autologous elements are not stably integrated into the genome. For example, transient expression of autologous elements is preferred to in trans activate translocations of missing transgenic elements, such as Ds, but stable binding of autologous elements is undesirable. It is undesirable to have an autogenous element present to stabilize the missing element, ie to prevent translocation. However, where stable integration of autogenous displaceable elements in the plant is desired, it may be possible to eliminate autologous elements during the breeding process by the presence of negative selectivity markers. (vi) non-protein-expressing sequences 1. RNA-expression Plant phenotypes can introduce DNA into grains and other monocots for the purpose of expressing RNA transcripts that have a functioning function but not translating them into proteins. Two examples are antisense RNAs and RNAs having ribozyme activity. They can function to reduce or eliminate the expression of native and introduced plant genes. When transcribed, one can construct or isolate genes that produce antisense RNA complementary to all or a portion of the target messenger RNA. Antisense RNA reduces the production of polypeptide products of messenger RNA. The polypeptide product can be any protein encoded by the plant genome. The aforementioned genes are called antisense genes. Antisense genes can be introduced into plants by transformation methods, resulting in novel transformed plants that reduce the expression of the selected protein of interest. For example, proteins can be enzymes that catalyze reactions in plants. Reducing the enzyme activity can reduce or eliminate reaction products, including compounds synthesized enzymatically in plants such as fatty acids, amino acids, carbohydrates, nucleic acids, and the like. Alternatively, the protein may be a storage protein or structural protein such as Jane, and their expression may be reduced, leading to an amino acid composition or morphological change of the plant in the seed. The foregoing is possible through the examples but does not represent a full scope of application. When transcribed, the RNA enzyme, ribozyme, can be produced to construct or isolate a gene that acts as an endoribonuclease to catalyze the cleavage of the RNA molecule having the selected sequence. By cleaving selected messenger RNAs, the production of polypeptide products encoded by them can be reduced. Such genes can be used to prepare new transformed plants bearing them. Transformed plants have reduced polypeptide levels, including but not limited to the aforementioned polypeptides affected by antisense RNAs. Genes can be introduced to create novel transformed plants with reduced expression levels of native gene products by co-inhibition mechanisms. Tobacco, tomato, petunia (Goring et al., 1991; Smith et al., 1990; Napoli et al., 1990; van der Krol et al., 1990) as seen in antisense genes as expression of sense transcripts of native genes. In a similar manner as can be done, the expression of native genes can be reduced or eliminated. The introduced gene encodes all or part of the native protein of interest, but no translation is required to reduce the level of native protein. 2. Non-RNA-Expression DNA elements, including displaceable elements such as Ds, Ac, Mu, are inserted into the gene to cause mutations. Such DNA elements are inserted to inactivate (or activate) genes to "tag" certain traits. In this case, displaceable elements do not cause instability of tagged mutations, because the usefulness of these elements does not depend on their ability to move into the genome. Once the desired trait is tagged, the introduced DNA sequence is used to clone the corresponding gene, eg, DNA introduced into the PCR primer with the PCR gene cloning technique (Shapiro, 1983; Dellaporta et al., 1988). Sequence is used. Once identified, the entire gene (including regulatory and control portions) of a particular trait can be isolated, cloned and regulated. The availability of DNA elements introduced into an organism for the purpose of genetic tagging is independent of the DNA sequence and independent of any biological activity of the DNA sequence, eg, transcribed into RNA or translated into protein. The pure function of the DNA element is to destroy the DNA sequence of the gene. Unexpressed DNA sequences, including novel synthetic sequences, are introduced into cells such that these cells, plants, and seeds are "labeled". Labeling DNA elements that destroy the function of endogenous genes in host organisms is not essential because the pure function of such DNA is to confirm the gene's origin. For example, a unique DNA sequence can be introduced into a plant to identify all cells, plants, and descendants of these cells as those DNA elements come from labeled sources. Inclusion of the label DNA can distinguish the germplasm possessing the label from germplasm derived from the unlabeled germplasm. Another possible element that can be introduced is the Matrix Attachment Partial Element (MAR), for example the chicken lysozyme A element (Stief, 1989), which is located around the desired expressible gene and affects the overall expression of the gene, To reduce site-dependent effects (Stief et al., 1989; Phi-Van et al., 1990). IX. Site-specific binding or cleavage of foreign transgenes In the present invention, a description will be given of using a technique for site-specific binding or cleavage of the foreign introduction gene prepared by the present invention. The advantage of site-specific binding or cleavage is associated with transgenic transformation techniques when used, and foreign transgenes can generally solve problems such as randomly binding to the host genome, multiple copies, and the like. When DNA introduced into the genome of a host cell is randomly inserted, it may die when foreign DNA is inserted into essential genes. In addition, the expression of foreign transgenes may be affected by "location effects" by surrounding genomic DNA. In addition, in the transformation of multiple copy foreign genes, it is necessary to control the number of copies of the inserted DNA when only one copy of the DNA sequence is to be inserted due to difficulty in gene silencing, recombination, and unexpected inheritance. . Homologous recombination in plants allows site-specific binding or cleavage of foreign transgenes (U.S. Patent No. 5,527,695). The reaction is homologous recombination between any DNA sequence with similar nucleotide sequences, such as two sequences interacting with each other (recombining) to form a new recombinant DNA species. The frequency of homologous recombination increases as the length of the shared nucleotide DNA sequence increases, with a higher proportion in linearized plasmid molecules than in circular plasmid molecules. Homologous recombination may occur between two less identical DNA sequences, but the recombination frequency decreases as the difference between the two sequences increases. The DNA sequence introduced by homologous recombination can be targeted by linking a DNA molecule of interest to a sequence having homology with the endogenous sequence of the host cell. Once the DNA enters the cell, two homologous sequences interact to insert the introduced DNA into the site where the homologous genomic DNA sequence is located. Thus, the selection of homologous sequences included in the introduced DNA can determine the site to which the introduced DNA is bound by homologous recombination. For example, if the desired DNA sequence is linked to a DNA sequence that shares homology to a single copy gene of a host plant cell, the DNA sequence of interest can be inserted through homologous recombination at only one particular site. However, if the desired DNA sequence is linked to a DNA sequence that shares homology to multiple copies of host eukaryotic cells, the DNA sequence of interest can be inserted by homologous recombination at each of the specific sites where the gene copy is located. DNA can be inserted into the host genome by homologous recombination via one interrecombination (full length of introduced DNA is inserted) or double intercombination (only DNA located between two recombination processes is inserted). For example, if you want to insert an external gene into the genomic region where the selected gene is located, the introduced DNA must have a homologous sequence to the selected gene. Then, due to single homologous recombination, the entire DNA sequence introduced can be inserted into the selected gene. Or double recombination is performed by placing a DNA sequence homologous to the selected gene to the side of each end of the DNA sequence of interest. Thus, only the DNA sequences located between two parts that share homology of the genome are allowed to bind to the genome. Homologous recombination allows targeted insertion of sequences introduced into specific genomic sites, but homologous recombination is relatively rare when compared to random insertion in higher eukaryotic cells. In plant cells foreign DNA molecules find homologous sequences in the cell's genome and can be recombined at a frequency of 0.5-4.2 × 10 −4 . Thus, any transformed cell comprising an introduced DNA sequence bound by homologous recombination may include many copies of the introduced DNA sequence bound randomly. Thus, in order to maintain the position and control of the copy number of the inserted DNA, such randomly inserted DNA sequences can be removed. One way to remove such random inserts is to use a site specific recombinant enzyme system. Generally, site specific recombinant enzyme systems consist of three components; Two pairs of DNA sequences (site-specific recombinant sequences); Specific enzymes (site specific recombinant enzymes). Site-specific recombinases catalyze that recombination occurs only between two site-specific recombination sequences. In the present invention, various other site-specific recombinant enzyme sequences can be used, including Cre / lox system of bacteriophage P1 (U.S. Patent No. 5,658,772); East's FLP / FRT system (Golic and Lindquist, 1989); Phage Mu Gin recombinase (Maeser et al., 1991); Pin recombinase of E. coli (Enomoto et al., 1983); R / RS systems of pSR1 plasmids (Araki et al., 1992) and the like. The FLP / FRT system of bacteriophage P1 Cre / lox and yeast consists of two systems that can be used for site-specific binding or cleavage of foreign transgenes. In these systems, recombinases (Cre or FLP) specifically interact with their respective site-specific recombinant sequences (lox or FRT) to thermocouple or cleave the intervening sequences. Each sequence in these two systems is relatively short (34 bp for lox; 47 bp for FRT). Therefore, it is convenient to use as a transformation vector. The FLP / FRT recombinase system has been described to function effectively in plant cells. Experiments running the FLP / FRT system on corn and rice protoplasts have shown that the FRT site Savior and the amount of FLP protein present affect cleavage activity. In general, shorter and incomplete FRT sites accumulate more cleavage products when compared to full-length FRT sites. The system catalyzes intramolecular and intermolecular reactions in corn plasma, indicating that it can be used for DNA cleavage and insertion reactions. Recombinant reactions are reversibly such reversible, which compromises the efficiency of the reaction in each direction. Altering the structure of site-specific recombinant sequences is also one way to cure this situation. Site-specific recombinant sequences are mutated to stabilize the binding or cleavage process so that the product of the recombinant reaction is no longer recognized as a substrate of the reverse reaction. In the Cre-lox system, it was found that in bacteriophage P1, recombination between loxP sites occurs in the presence of Cre recombinase (see, e.g., U.S. Patent No. 5,658,772). Using this system, a gene was cut between two lox sites introduced into the yeast genome (Sauer, 1987). Cre is expressed in yeast's inducible GAL1 promoter, where the Cre gene is located on a native replicable yeast vector. Because lox positions are asymmetric nucleotide sequences, lox positions located on the same DNA molecule can have the same or opposite directions to each other. DNA fragments that are recombinantly located between two lox positions between the lox positions in the same direction are missing, linking the resulting ends of the native DNA molecules. The missing DNA fragment creates a circular DNA molecule. The unique DNA molecule and the resulting circular DNA molecule each have one lox site. When recombination occurs between lox sites in the opposite direction on the same DNA molecule, the nucleotide sequence of the DNA fragment located between the two lox sites is reversed. In addition, interchange of DNA fragments may occur at the front end of the lox position located in two different DNA molecules. All such recombination processes are catalyzed by the product of the Cre coding portion. X. Purification of Proteins In certain embodiments of the invention, it is desirable to purify the protein encoded by the exogenous transgene of the invention. Or the native protein is isolated from the plant to clone the gene encoding the isolated protein or as part of expression by a promoter of the gene. Once the protein is present, the protein is sequenced and the coding sequence of the gene is inferred. Probes or primers can be made based on the inferred DNA sequences, thereby effectively cloning the corresponding genes. Protein purification techniques are known in the art. Such techniques include coarse fractionation of the cellular environment into polypeptide and non-polypeptide aliquots. When the polypeptide is separated from other proteins, the polypeptide of interest can be further purified using chromatography and electrophoresis techniques to perform partial or complete purification. Suitable assay methods for preparing pure peptides include ion-exchange chromatography, extrusion chromatography; Polyacrylamide gel electrophoresis, isoelectric focus, and the like. Particularly effective methods for purifying peptides are rapid protein liquid chromatography or HPLC. Various techniques that can be used for protein purification are known in the art. For example, centrifugation after precipitation, heat denaturation using ammonium sulfate, PEG, antibodies and the like; Chromatography such as ion exchange, gel filtration, reverse phase, hydroxyapatite, affinity chromatography; Isoelectric focus; Gel electrophoresis and combinations of these and other techniques. In general, as is known in the art, the order of performing the various purification steps may be reversed, and certain steps may be omitted, and may be suitable methods for preparing the actual purified protein or peptide. There is no general rule that a protein or peptide should be provided in the most purified state. In addition, somewhat less purified products may be used in certain embodiments. Partial purification can be achieved by using several purification steps or by using the same overall purification process in somewhat different forms. For example, cation-exchange column chromatography performed using an HPLC apparatus can obtain "-fold" purification than the same technique using a low pressure chromatography system. Relatively less purified methods may be beneficial in maintaining the overall recovery of the protein product or the activity of the expressed protein. It is known that the movement of polypeptides on SDS / PAGE under different conditions varies and in some cases differs significantly (Capaldi et al., 1977). It will be appreciated that under various other electrophoretic conditions, the apparent molecular weight of the purified or partially purified expression product may vary. HPLC is characterized by very fast separation with unique dissociation peaks. Very fine particles and high pressure are used to maintain the proper flow rate. Separation takes place in minutes to hours. It is also possible with very small amounts of samples, as the particles are very small or because the void volume is densely packed which becomes a very small part of the bad volume. In addition, because the band is quite narrow, the sample is hardly diluted so that the sample concentration does not need to be very high. Gel chromatography or molecular filtration chromatography is a form of fractional chromatography based on molecular size. The theory of gel chromatography is a column prepared with an inert material containing small pores, which can separate small and large molecules as they pass through or pass through the pores, depending on their size as they pass through the column. Unless the material that makes up the particles absorbs the molecules, the only factor that determines the flow rate is size. Thus, if the shape of the molecule is relatively constant, the molecules are eluted from the column in decreasing order of size. Gel chromatography is not an excellent method for separating molecules of different sizes, because such separation is independent of all other factors such as pH, ionic strength, temperature, and so on. There is also no adsorption, less zone spread, and elution volume is related to molecular weight. Affinity chromatography is a chromatographic process based on specific affinity between an isolated substrate and molecules that specifically bind to it. This is a receptor-ligand interaction. Column materials are synthesized by covalently binding bond pairs on the insoluble matrix. The column material can then specifically absorb the substrate in solution. Elution can be performed while changing conditions (eg, pH, ionic strength, temperature, etc.) so that no binding occurs. Chino-heavy chromatography useful for purifying compounds comprising carbohydrates is lectin affinity chromatography. Lectins are substrates that bind to various polysaccharides and glycoproteins. Lectins are typically bound to agarose by cyanogen bromide. Concanavalin A bound to cytorose has been widely used to separate polysaccharides and glycoproteins as well as other lectins as the first material of this kind. Other lectins include N-acetyl glutozaminyl residue purification and lentil lectin, malt aglutinin, used to purify Helix pomatia lectin. Lectins themselves can be purified by affinity chromatography with carbohydrate ligands. Lactose was used to purify the lectins from castor seed and peanuts; Maltose is used to extract lectins from lentils and jack beans; N-acetyl-D galactosamine is used to purify the lectins in soybeans, and N-acetyl glucozaminyl binds to the lectins of malt; D-galactosamine is used to obtain lactin from clam, and L-fucose can bind to lectins in Lotus. The matrix does not absorb molecules to a great extent and is a substrate having a wide range of chemical and physical thermal stability. Ligands should be bound in a way that does not affect their binding properties. The ligand should provide a relatively tight bond. In addition, the substrate must be eluted without degradation of the sample or ligand. One of the most common forms of affinity chromatography is immunoaffinity chromatography. Antibodies suitable for use in the present invention can be made as follows. XI. Justice Exogenous genes; While not normally present in a given host genome, the gene itself is unique to the host genome, but a hereditary gene consists of a native gene that has been modified by the addition or deletion of one or more other regulatory elements. One exogenous gene that we consider to be particularly useful in the present invention consists of a corn gene linked to a promoter taken in Coix. Expression; To produce a polypeptide, it refers to an intracellular complex process involving transcription and translation carried out by a coding DNA sequence such as a structural gene. descendant; Any subsequent generation, including seeds or plants thereof, is derived from a particular parent plant or parent plant set. Promoter; Recognition sites in DNA sequences or populations of DNA sequences that specifically bind RNA A polymerase to provide expression control elements for structural genes that initiate RNA synthesis (transcription) of these genes Occur; The process of growing a plant from plant cells (such as the plant's plasma or explants). Selected DNA; DNA fragments introduced into the host genome. Appropriately selected DNAs include one or more exogenous genes and elements, promoters and terminators that express exogenous genes in host cells. It is beneficial if the selected DNA and one or more enhancer elements are included. Transformation; The process of introducing an exogenous DNA sequence or structure (such as a vector or an expression cassette) into a cell or protoplast, whereby the exogenous DNA can bind to itself or replicate itself. Transformed cells; A cell whose DNA has been altered by introducing exogenous DNA molecules into the cell Foreign introduction genes; DNA fragments introduced into the host genome. The exogenous gene provides a novel novel phenotype that corresponds to a cell or plant that has not been transformed into a host cell or plant generated therefrom. The exogenous transgene encodes only proteins and RNA, and does not encode portions that are not transcribed or untranslated. Individual plants can be provided with foreign transgenes by transformation or by inheritance from the plant's father. Transformed cells; Any cell generated or derived from a transformed cell, such as a plant, leaf, root, stem, somatic cell derived from a transformed plant cell, or a regenerated (germ) cell obtained from a transformed plant. . Transformed plants; Any generation of plant or descendant derived from a transformed plant cell or protoplast, wherein the plant DNA includes introduced exogenous DNA that is not desired and present in a native, untransformed plant of the same species. Transformed plants can further include sequences unique to the transformed plant, provided that "exogenous genes" can be modified using genetic techniques to alter the expression levels and patterns of the genes. Carrier peptides; A polypeptide sequence capable of directing a polypeptide to a particular organ or other location within a cell. vector; A DNA molecule capable of replicating in a host, which is linked to another DNA fragment for replication of the attached fragment. Plasmids are DNA molecules used to carry novel genes into representative vectors or cells. Plasmids are independent stable self-replicating DNA fragments. XII. Example The following examples include describing suitable embodiments of the invention. Those skilled in the art will describe examples presenting techniques that the inventors have discovered in order to practice the present invention well. However, one of ordinary skill in the art, in light of the present invention, may make many variations in the described embodiments, and such changes may yield similar or identical results without departing from the scope of the present invention. More specifically, the same or similar results can be obtained by replacing certain reagents, both chemically and physiologically related, with the reagents described herein. All such similar substitutions and variations will be appreciated by those skilled in the art. Example 1 Cloning of Homologous Sequences from Coix Coix lacryma-jobi seeds (PI 320865) were obtained from USDA / ARS Plant Introduction Station, Ames, IA. It germinated and grew in greenhouses for several weeks. Genomic DNA was prepared from 2-3 weeks old leaves according to the following procedure. Frozen leaf tissue (2 g biomass) is ground to a fine powder using a glass rod under liquefied nitrogen. The powdered tissue is mixed with 8 ml extraction buffer (100 mM Tris, pH 8.0; 50 mM EDTA; 1% v / v SDS; 500 mM NaCl), preheated to 60 ° C. and incubated at 60 ° C. for 45 minutes. The sample is then mixed with 5M acetate potassium cooled with 2.5 ml ice and left on ice for 20 minutes. Protein aggregates are removed by centrifugation at 3750 rpm for 20 minutes, the supernatant is triturated through the Miracloth layer and mixed with 5 ml isopropyl alcohol to precipitate DNA. Precipitated DNA is collected by centrifugation at 3750 rpm for 15 minutes, the supernatant is decanted from the pelletized DNA, and the tube is inverted for 5 minutes to allow residual supernatant to escape from the pellet. DNA is resuspended with 300 μl water containing 50 mM Tris, pH 8.0, 10 mM EDTA, 3 μl RNase (10 mg / ml stock). Again with 50 μl 4.4 M acetate ammonium (pH 5.2), mix with 350 μl isopropyl alcohol and centrifuge for 10 min at 14,000 rpm to precipitate DNA. DNA pellets are washed with 750 μL 80% v / v ethanol and inverted for 10 minutes to drain. DNA is resuspended with 200 μl water containing 10 mM Tris, pH 8.0, 1 mM EDTA. Genomic DNA libraries to be used as PCR templates are made using Genome Walker PCR kits (Clontech, Palo Alto, CA) according to the manufacturer's instructions. The DNA fragment located 5 'of the gamma coicin protein coding sequence is PCR amplified as follows. Oligonucleotide primers are made as follows; gCoix5 'nest2 (SEQ ID NO: 1); gCoix5 'nest3 (SEQ ID NO: 2)-these correspond to positions 267-288 and 26-53 of the published gamma coicin sequence (Genbank Accession number X59850), respectively. Primers designated as AP1 (SEQ ID NO: 3) and AP2 (SEQ ID NO: 4) are used, which are provided in the "Genome Walker" kit (Clontech). Primer sequences are as follows; gCoix5 'nest2 = CTGGAACTGGAACGGGCTTGGA gCoix5 'nest3 = GCGAGGGCAACGAGCAGCACCTTCATGG AP1 = GTAATACGACTCACTATAGGGC AP2 = ACTATAGGGCACGCGTGGT PCR reactions are carried out as follows; First, a Long Template PCR system (Boehringer Mannheim (Indianapolis, Ind.)) Is used, following the manufacturer's instructions, except for 350 μM dNTP's, 500 nM primers, 50 mM Tris-HCl, pH 9.2; The difference is that it contains 14 mM (NH 4 ) 2 SO 4 , 3.0 mM MgCl 2 , 2 μl (<25 ng) template DNA (Genome Walker library). The primers first used are gCoix5 'nest2 and the adapter promoter AP1. The following cycle conditions are used, in which a MJ Research PTC-100 thermocycler with a heated lid is used. 95 ° C.-1 min. 1 cycle 94 ° C.-30 seconds. 72 ° C.-3 minutes. 7 cycles 94 ° C.-30 sec. 67 ° C.-3 minutes. 32 cycles 67 ° C.-4 minutes. 1 cycle 4 ℃ -hold The product of this reaction is diluted 1:25 with water and 2 μl is used as template for the second amplification reaction. Primer is exchanged with gCoix5 'nest3 and adapter primer AP2. Other changes include the stock price process itself; 95 ° C.-1 min. 1 cycle 94 ° C.-30 sec. 72 ° C.-3 minutes. 5 cycles 94 ° C.-30 seconds. 67 ° C.-3 minutes. 20 cycles 67 ° C.-4 minutes. 1 cycle 4 ° -hold Gel electrophoresis and band cleavage separate the appropriately sized bands (500 bp or greater) and, according to the manufacturer's instructions (Invitrogen, Carlsbad, Calif.), Are cloned into the plasmid vector pCR2.1. DNA is sequenced using conventional oligonucleotide or vector-linearized primers and ABI dye-deoxy sequencing kit (Perkin-Elmer, Applied Biosystems, Norwalk, CT), and the sequencing reaction is performed using an ABI Prism 373 DNA sequencer (Perkin- Elmer, Applied Biosystems). After obtaining the sequences at the 3 'and 5' ends of the PCR product, the primers are designed to have conventional restriction enzyme cleavage sites, allowing for the amplification and cloning of the gamma coicin promoter directly in genomic DNA. Primers gcx-1000seq5'xho (SEQ ID NO: 5), gcx-1pcr3'xba (SEQ ID NO: 6) and gcx-1pcr3'nco (SEQ ID NO: 7) were synthesized. Primer sequences are as follows; gcx-1000seq5'xho = GGCTCGAGGGACCGGTTACAGCACACCACTG gcx-1pcr3'xba = GGTCTAGAGGTGTCGATCTTCTGTGCTCT gcx-1pcr3'nco = GGCCATGGGGTGTCGATCTTCTGTGCTCT Gamma coicin promoter amplification was performed with gcx-1pcr3'nco and gcx-1000seq5'xho primers using the High Fidelity PCR Kit (Boehringer Mannheim). The reaction mixture contains 200ng Coix genomic DNA template, 200μM dNTPs, 500nM each primer, 5μl 10X buffer # 2. Each cycle condition performed using the MJ Research PTC-100 thermocycler with heated lid is as follows; 95 ° C.-2 minutes. 1 cycle 94 ° C.-1 min. 56 ° C.-1 min. 72 ° C.-1 min. 32 cycles 72 ° C.-4 minutes. 4 ℃ -hold After amplification, the amplicons are cleaved with NcoI and XhoI and cloned into the GUS expression vector pDPG827 (mcs / GUS / nos in pSP72 backbone; Promega Corp., Madison, Wis.). The entire promoter insert as well as the insertion junctions are sequenced and the vector is called pDPG844 (FIG. 1). DNA sequencing is then performed using conventional oligonucleotide or vector-linearized primers and ABI dye-deoxy sequencing kit (Perkin-Elmer, Applied Biosystems, Norwalk, CT). Sequencing reactions were analyzed using an ABI Prism 373 DNA sequencer (Perkin-Elmer, Applied Biosystems). The sequence of the promoter insert is provided in SEQ ID NO: 8. Amplify gamma coicin promoter fragments side by side using gcx-1pcr3'xba and gcx-1000seq5'xho primers. The amplification product is cleaved with XbaI and XhoI and ligated to GUS expression vector pDPG828 (mcs / rice Actin intron I / GUS / nos in pSP72). Insert junctions and entire inserts were sequenced and the vector is called pDPG845 (FIG. 2). To construct plasmids pDPG846 (FIG. 3) and pDPG847 (FIG. 4), the High Fidelity PCR Kit (Boehringer Mannheim) and gcx-1pcr3'xba (SEQ ID NO: 6), gcx- (400) pcr5'xho (SEQ) ID NO: 24) gamma coicin promoter amplification was carried out using primers. The amplification products were cleaved with XbaI and XhoI and ligated into the GUS expression vectors pDPG827 (mcs / GUS / nos in pSP72 backbone) and pDPG828 (mcs / rice Actin1 intron1 / GUS / nos pSP72), respectively called pDPG847 and pDPG846. The junction and the entire insert are sequenced and the sequence of the promoter insert is provided in SEQ ID NO: 19. Plasmids pDPG848 (FIG. 5) and pDPG849 (FIG. 6) are constructed side by side with the pDPG846 and pDPG847 constructs. Gamma coicin promoter fragments are PCR amplified using the High Fidelity PCR Kit (Boehringer Mannheim) and primers gcx-1pcr3'xba (SEQ ID NO: 6), gcx- (220) pcr5'xho (SEQ ID NO: 25) . The amplified product was cleaved with XbaI and XhoI and ligated into GUS expression vectors pDPG827 (mcs / GUS / nos in pSP72 backbone) and pDPG828 (mcs / rice Actin1 intron1 / GUS / nos in pSP72) to make pDPG849 and pDPG848, respectively. . Insert junctions and entire inserts are sequenced and the sequences of the promoter inserts are provided in SEQ ID NO: 18. The sequences of gcx- (400) pcr5'xho and gcx- (220) pcr5'xho are as follows and are provided in respective SEQ ID NO: 24 and SEQ ID NO: 25; gcx- (400) pcr5'xho GGCTCGAGTAAGTATGCAGGA gcx- (220) pcr5'xho GGCTCGAGCACTCGGCTTGCT Example 2 Isolation of Gamma Coicin Terminator and Coding Sequence and Construction of pDPG869 The Genome Walker kit and genomic DNA library used to isolate the gamma coicin promoter can also be used to separate gamma coicin terminator sequences. All PCR concentrations and cycle conditions remain the same as those used for promoter separation (Example 1). One change is the use of coicin-specific primers. The first round of PCR used primers gcx5'pcr2 (SEQ ID NO: 9) and AP1, and the second round used primers gCoix3'nest2 (SEQ ID NO: 10) and AP2. The sequence of the primer is as follows; gcx5'pcr2 = (CTCAGCCCCAGCAGCCACATCCA) gCoix3'nest2 = (GTGCGGGCAGCCAATGACAAGTC) The amplified product is separated by gel electrophoresis and bands of appropriate size, band eluted and separated, and according to the manufacturer's instructions (Invitrogen, Carlsbad, Calif.), The DNA is cloned into the vector pCR2.1 and sequenced. The clone comprising the gamma coicin terminator is called DV108 (Fig. 11) and the sequence of terminator is given in SEQ ID NO: 11. In order to obtain a gamma coicin protein coding sequence, PCR amplification is performed to isolate the amplification product comprising the coding sequence and promoter of the gamma coicin gene. Amplification is carried out using primers gcx-1000seq5'xho (SEQ ID NO: 12) and gCoix3'pcr (SEQ ID NO: 13), where the primer sequence is as follows; gcx-1000seq5'xho = GGCTCGAGGGACCGGTTACAGCACACCACTG gCoix3'pcr = TCAGTACTGGGCACCGCCGGC To optimize amplification, a "Master Amp" kit (Epicentre Technologies, Madison, Wis.) Is used. Buffer D and Robocycler (Stratagene) program can be used to obtain sequences of promoter / coding amplification products. 94 ° C.-2 minutes. 1 cycle 94 ° C.-1 min. 73 ° C.-1 min. 72 ° C.-1 min. 32 cycles 72 ° C.-4 minutes. 1 cycle 6 ° -hold This amplicon is cloned into pCR2.1. Using this plasmid structure as a template, the next PCR strategy is to obtain coding sequences and promoters as separate reaction products. The following primers gCoix5'pcr + 4 (SEQ ID NO: 14) and gCoix3'pcr + sac (SEQ ID NO: 15) are designed to amplify only coding sequences. gCoix5'pcr + 4 = AAGGTGCTGCTCGTTGCCCTC gCoix3'pcr + sac = GGGAGCTCTCAGTACTGGGCACCGCCGGC These primers correspond to bases 31-51 and 607-627 of the Genebank sequences shown above. Using the primer gCoix5'pcr + 4, an amplification product without the start codon of gamma coicin protein is obtained. A reaction mixture of High Fidelity PCR (Boehringer Mannheim), 100 pg plasmid template, 500 nM primers, 1 × Buffer 1, 200 μM dNTP, 3 mM MgCl 2 was used. Each cycle condition using the MJ Research PTC-100 thermocycler with heated lid is as follows; 95 ° C.-2 minutes. 1 cycle 94 ° C.-1 min. 62 ° C.-1 min. 72 ° C.-1 min. 32 cycles 72 ° C.-4 minutes. 1 cycle 4 ℃ -hold The reaction product is purified by gel electrophoresis and band cleavage, treated with SacI and cloned into pDPG845. Plasmid pDPG845 was treated with NcoI and successively filled the 5 'overhang with Klenow by adding 2unit Klenow enzyme and dNTP so that each final concentration was 0.2 mM. This directly ligates the ATG codon to the 5 'end of the gamma coicin protein coding sequence, restoring the complete open reading frame of gamma coicin. The vector is treated with SacI to remove the GUS coding sequence, leaving only the site comparable to the 3 'end of the gamma coicin coding sequence. The prepared pDPG845 vector and gamma coicin coding sequence are ligated with each other to obtain a new vector pDPG851 (FIG. 9). To replace the nos terminator of pDPG851 with gamma coicin terminator, the expression cassette is transferred to a more suitable vector, ie, pDPG851pBK-CMV (Stratagene, La Jolla, Calif.). This is done by treating pBK-CMV with ScaI (blunt), pDPG851 with XhoI and ClaI, and 5 'overhang with Klenow (2 units Klenow, 0.2 mM each dNTP). The pDPG851 cassette and pBK-CMV base structure are gel purified. Two plasmids are ligated to make pDPG862 (FIG. 10). Gamma coicin terminator is cloned at the 3 'end of the gamma coicin coding sequence in pDPG862. This is done by first removing the nos terminator and cloning the purified koiccin terminator in place by performing the steps indicated below. The gamma coicin coding sequence has a ScaI site at positions 620-625 of the reported Genbank sequence. This restriction enzyme site (in pDPG862 and DV108 as part of the coding sequence obtained by the Genome Walker procedure) is treated with ScaI and NotI. The gamma coicin terminator sequence is then gel purified, as performed in the pDPG862 framework. These two fragments are ligated to make pDPG869 (FIG. 7). The sequence of gamma coicin coding sequence is provided in SEQ ID NO: 16. Each of these gene constructs can be introduced by particle bombardment into regenerated cells of maize, as described in Examples 5 and 6. Example 3 Isolation of Coix Oleosin 3 Termination Substance Coix oleosin 3 terminators are isolated using the Genome Walker kit and genomic DNA library used to isolate promoter and terminator sequences in Examples 1 and 2. All PCR concentrations and stock price conditions are the same as those used in these examples. The only change is in the Coix specific primer used. Round 1 PCR uses primers cx-L3 3'nest1 (SEQ ID NO: 26) and AP1 (SEQ ID NO: 3), and round 2 uses primer cx-L3 3'nest2 (SEQ ID NO: 27). , cx-L3 3'nest 3 (SEQ ID NO: 28), and AP2 (SEQ ID NO: 4) were used. The sequence of the primer is as follows; cx-L3 3'nest1 CGGGCTGATCCTGGCCGGCACCGT cx-L3 3'nest2 GTGTTCTCCTGGATGTACAAGTAC cx-L3 3'nest3 TCCAAGGCCCGCGACGTCAAGGA The amplification product was subjected to gel electrophoresis and cutting of appropriately sized bands (> 500 bp), elution of the bands and isolation of the DNA into vector pCR2.1 (Invitrogen) according to the manufacturer's instructions. Sequencing as described above. Clones containing Coix oleosin terminator were designated DV112. The sequence of the oleosin terminator is provided in SEQ ID NO: 17. Example 4 Sequence Comparison of Gamma Coicin Promoter and Homologous Promoter of Corn and Sugar Cane Gamma-proramine is a type of seed storage protein present in the endosperm of Coix, sugar cane and corn. Coix cloned as described in Example 1 (gamma Coixin, SEQ ID NO: 8), gamma proramine promoter portion of the corresponding sequence of sugarcane (gamma kafirin, SEQ ID NO: 22, Genbank Accession No. X62480) and Analysis was performed to compare sequence similarity to the corresponding portions of maize (gamma zein, SEQ ID NO: 23, Genbank Accession No. X56117). Gene Works DNA analysis software (Intelligenetics, Inc., Mountainview, Calif.) Was used to sequence 894 nucleotides upstream of the detoxified codon. The gap was introduced and arranged. The 3 'end of each sequence corresponds to the ATG start codon. 8 and Table 9 show the comparison results. The analysis revealed that there was 65% sequence homology between gamma coicin and gamma caprin, and 63% homology between gamma coicin and gamma zein. The result is that the promoter part is quite different for each of the three species. Table 9 Example 5 Smile Projection Preparation Microprojection was prepared as follows; 60 mg 0.6 μm gold particles (BioRad, cat. No. 165-2262) are added to 1000 μl pure ethanol and placed at room temperature for at least 3 hours before storage at −20 ° C. to form gold particles. Sterile 20-35 μl gold particles or more suitably 30-35 μl gold particles (30 μl contain 1.8 mg indenter) are microcentrifuged for up to 1 minute. The supernatant is removed, 1 ml sterile water is added to the tube and centrifuged for 2-5 minutes at 1800-2000 rpm. Microprojection particles are resuspended in 25-30 μl DNA solution containing 250 ng vector DNA. 220 μl sterile water, 250 μl 2.5M CaCl 2 , 50 μl stock solution spermidine (14 μl spermidine in 986 μl water) is added to the solution containing the particles. The solution is mixed thoroughly and placed on ice, then stirred at 4 ° C. for 10 minutes and centrifuged at 500 rpm for 5 minutes. The supernatant is removed and the pellet is resuspended in 600 μl pure ethanol. After 5 minutes centrifugation at 500 rpm, the pellet is resuspended in 36-38 μl pure ethanol, stirred for about 20 seconds and sonicated for 20-30 seconds. At this stage the particles are typically left for 2-5 minutes, 5-10 μl of the supernatant is removed and dispersed on the pliers disk surface and the ethanol is completely dried. Alternatively, the particles are immediately resuspended and removed from the 36 μl-38 μl ethanol for 20-30 seconds immediately after placement, placed on a pliers disk and dried. The bombardment chamber discharges 28 Hg prior to implementation. Subsequently, particle bombardment was performed using a DuPont Biolistics PDS1000He particle bomber at about 1100 psi. Example 6 Bombardment of Hi-II Immature Boats Immature embryos of grain genotype Hi-II (1.2-3.0 mm in length) are cut out from the ears grown in a surface-sterilized greenhouse of Hi-II 10 to 12 days after moisture. Hi-II genotypes were generated from A188 × B73 crosses (Armstrong et al., 1991). About 30 embryos per culture dish were modified with N6 medium (1 mg / l 2,4-D, 100 mg / l casein hydrolysate, 6 mM L-proline, 0.5 g / l 2-(morpholine) ethanesulfonic acid (MES ), Containing 0.75 g / l MgCl 2, 2% sucrose, solidified to 2 g / l Gelgro, pH 5.8 (# 735 medium)). Embryos are incubated in the dark for 2-4 days at 24 ° C. About 3-4 hours before bombardment, the embryos are transferred to the culture medium, with the concentration of sucrose increasing from 3% to 12%. When embryos are transferred to high osmotic medium, their root ends are directed towards the center of the dish, starting at 1 cm from the center of the dish and arranged to draw concentric circles. Typically two concentric circles are formed when there are 25-35 embryos on the plate. The plate containing the vessel is placed on the third shelf from the bottom, about 5 cm below the still screen. Bombard using a 1100 psi bursting disc. Each boat plate is bombarded with a DuPont Biolistics PDS1000He particle gun. After bombardment, the vessels were recovered overnight (16-24 hours) in a high osmotic medium (735, 12% sucrose) and 1 mg / l bialphos (# 739, 735 plus 1 mg / l bialaphos or # 750, 735 plus 0.2 M mannitol, 1 mg / l bialphos). Embryos are kept in 24 ° C dark conditions. After 3-4 weeks, about 90% of the embryos on the initial selection plate generally form Type II coalesced tissue and transfer them to selective medium containing 3 mg / L bialphos (# 758). Sudden analysis was used to analyze the transformants and run gene expression tests. Table 10 provides the number of constructs and transformants used for transformation. Table 10 Example 7 Determination of putative promoter regulatory elements Identifying the putative regulatory components within each promoter sequence begins by comparing the promoter sequences known to be expressed in a similar tissue specific or embryologically unique manner. Shared sequences between promoters with similar expression patterns are candidates for binding transcription factors, which may be elements that confer expression patterns. Such putative regulatory elements can be confirmed by functional analysis of each defective structure by defect analysis of each promoter and reporter gene test functionally attached to each structure. This analysis is performed on the cloned gamma coicin promoter. As described in Example 4, the arrangement of the DNA sequences of the corn gamma zein and the sugarcane gamma capyrin gene promoter and the Coix gamma coicin promoter reveals some short homologous moieties that serve as potential transcription factor binding sites. Some of these sites have already been identified as putative regulatory portions of the sugarcane storage protein promoter (Ottoboni et al., 1993; de Freitas et al., 1994). Four presumed adjustments were identified. Both parts appear to confer overall promoter activity in response to the nitrogen state, and these parts are termed GCN4-like parts. Two additional moieties confer tissue-specific expression, which is termed proramin-box binding moiety. The elements are arranged between 180 and 700 bp at the start of the translation, GCN4 box, proramine box (-395 bp), second GCN4 box (-525 bp), and second proramin, which are sheared at the starting methionine codon (-190 bp). Box (-650bp) is arranged. The truncated promoter sequence created promoter fragments of 412 bp (SEQ ID NO: 19) and 222 bp (SEQ ID NO: 18) (distance from the site of detoxification) to specifically remove the presumed tissue-specific regulatory elements. . The 412 bp promoter fragment contains only the shear GCN4 and proramine motifs, while the 222 bp fragment contains only the two prolamin box portions and the shear GCN4 motif removed. In addition to the full-length gamma coicin promoter, such promoter fragments can be cloned into a vector containing the GUS reporter gene to enhance expression, with or without the use of actin 1 in rice. Such vectors are designated as pDPG844, 845, 846, 847, 848, and 849, and their construction has been described above. Each construct was bombarded with immature corn pears (as described in Example 6), and plants were generated, including each promoter: GUS construct, as a foreign introduction gene. The expression of the GUS reporter gene in all plant tissues at many different stages of development is analyzed in plants containing such foreign transgenes. The shortest promoter constructs (221 bp, pDPG848, pDPG849) do not have a tissue-specific expression pattern, which appears to be due to the lack of a prolamin-box regulatory region. In addition, the promoter constructs pDPG846 and pDPG847 at 412 bp retain tissue-specificity, but have low expression levels when compared to full-length promoter constructs (pDPG844 and pDPG845). Example 8 Sense Inhibition and Removal of Inhibition of the α-Zane Gene in Transformed Corn Using the Coix Promoter When the zein gene is regulated by the corn promoter, it was seen that endogenous maize expression inhibition was induced by expression of the sense zein expression cassette in maize. To demonstrate that such inhibition does not occur when using Coix promoters, transformation studies were run and the constructs expressed by the corn or Coix promoters were compared. This study was carried out as follows. Corn cells were transfected with the plasmid vector pDPG531, which consists of a corn Z27 promoter linked to a corn Z4 sense coding portion and a nopalin synthetase at the 3 'portion (this is a US patent filed Dec. 9, 1996). Described in application 08 / 763,704). About 960 base pairs are cut out from the vector SPZ4Ent and the ends are filled to make pDPG531 (US Patent Application 08 / 763,704, filed Dec. 9, 1996). Basically, the entire Z4 transcription unit is included in SPZ4Ent, with a total of 960 nucleotide inserts. The Z4 gene was rebuilt in two Z4 subclones, pSPZ4R3 'and pSPZ45'. The parent vector is pSPZ4R3 'comprising 713 nucleotides of the 3' nucleotide sequence from nucleotide 630 to nucleotide 1341 of the repeating Z4 sequence. The 5 'end of the Z4 sequence was released by treatment with SacI (cutting off the polylinker sequence on the outside of the inserted gene) and BamHi, and 5 of pSPZ45' obtained by treatment with SacI (cutting off the polylinker sequence) and BamHI. The insert comprising the sequence is ligated to linearized pSPZ4R3 to reconstruct the native Z4 transcription unit. The resulting vector consists of the Z27 promoter :: Nos 3 'substructure in pBSK (-) which contains the only NcoI site between the promoter and terminator. The vector and the insert both have blunt ends and are ligated. A clone having the sense direction of the Z4 DNA sequence was identified (pDPG531). pDPG531 is capable of transcription and translation of 22 kD zein protein (α-Zane). Plasmids pDPG531 and pDPG165 were introduced into maize cells using the co-shelling method as follows. Transformants are made as described in PCT publication WO 95/06128 and US patent application 08 / 763,704 filed Dec. 9, 1996. The process is as follows; Corn plants of genotype A188 × B73 are crossed to Hi II corn plants (Armstrong et al., 1991). Immature pears (1.2-2.0 mm in length) are cut from the ears grown in a surface sterilized greenhouse about 11-12 days after moisture. Hi-II genotype was generated from A188 × B73 crosses (Armstrong et al., 1991) for high frequency invention of type II from immature embryos. About 30 embryos per culture dish were modified with N6 medium (1 mg / l 2,4-D, 100 mg / l casein hydrolysate, 6 mM L-proline, 0.5 g / l 2-(morpholine) ethanesulfonic acid (MES ), Containing 0.75 g / l MgCl 2, 2% sucrose, solidified to 2 g / l Gelgro, pH 5.8 (# 735 medium)). Embryos are incubated in the dark for 2-4 days at 24 ° C. About 4 hours before bombardment, the embryos are transferred to the culture medium, with the concentration of sucrose increasing from 3% to 12%. When embryos are transferred to high osmotic medium, their root edges are directed towards the center of the dish, starting at 2 cm from the center of the dish and arranged to draw concentric circles. Typically two concentric circles are formed when there are 25-35 embryos on the plate. The plate containing the vessel is placed on the third shelf from the bottom, about 5 cm below the still screen. Bombard using a 1100 psi bursting disc. Each boat plate is bombarded with a DuPont Biolistics PDS1000He particle gun. Pears are recovered overnight in high osmotic media. After recovery on an osmotic medium (735, 12% sucrose) overnight (16-24 hours), the embryos were harvested on 1 mg / l bialphos (# 739, 735 plus 1 mg / l bialaphos or # 750, 735 plus 0.2 M mannitol, 1 mg / l bialphos) is transferred to the selection medium. Embryos are kept in 24 ° C dark conditions. After 3-4 weeks, about 90% of the embryos on the initial selection plate generally form Type II coalesced tissue and transfer them to selective medium containing 3 mg / L bialphos (# 758). Non-Alphas resistant tissues are second incubated every three weeks in fresh selection medium (# 758). Transformed embryonal callus is transferred to regeneration culture medium (MS culture medium (Murashige and Skoog, 1962), 0.91 mg / L L-asparagine, 1.4 g / L L-proline, 20 g / L D-sorbitol, 0.04 mg / l naphthalene acetic acid (NAA), including 3 mg / L 6-benzylaminopurine). Cells are grown on this culture medium for about 4 weeks and transferred to fresh medium about every 2 weeks. Transformants are transferred to MS0 culture medium (MS medium without phytohormone added). Transfer the regenerated plants to the soil. Plants are bred with corn breeding strains designated AW, CV, and DJ. Seeds containing the Z27-sense expression cassette are opaque with phenotypes similar to opaque-2 mutant grains. Plants are regenerated in three Z27-Z4 sense expression cassettes and hybridized with homologous strains designated AW, CV, and CN. The amount of α-Zane protein present in the untransformed corn plants and α-Zane protein present in the Z27-Z4 sense transformant was compared on a Coomassie blue colored polyacrylamide gel as described below. 50 mg ground kernels are resuspended in 0.5 ml 70% ethanol, 1% β-mercaptoethanol and extracted for 30 minutes at room temperature overnight. The sample is stirred and centrifuged for 5 minutes at 12,000 rpm. Remove 50 μl containing zein protein and dry. Jane protein is resuspended 50: 1 in SDS polyacrylamide gel loading buffer (including 1% β-mercaptoethanol). Proteins are separated on SDS polyacrylamide gels and stained with Coomassie Blue. As a result, it can be seen that the protein level of α agent present in the Z27-Z4 sense transformant is significantly reduced. This reduction was comparable to that of antisense transformation. In addition to the reduced zein protein concentration in the sense transformant, the seed with reduced zein content generally had an opaque phenotype, and the Z27 zein level also decreased. Lysine and leucine concentrations in the seeds from each grain were analyzed. The amino acids were extracted from mature grains derived from three separate transformed strains as follows. 50 mg of ground grains are hydrolyzed in 1 ml 6N HCl for 11 h 24 h under argon gas. Samples are diluted to 50 ml and filtered through 0.45 micron filter. Norvalin is added to each sample and used as internal standard before HPLC analysis. Amino acids were isolated on Superlcosil LC-8 HPLC columns (Jarrett et al., 1986; Jones et al., 1983; AACC, 1995). Analysis of one grain showed significant differences between the transformed and untransformed grains (p <0.05). Lysine and leucine Hujun in one transformant, KQ018, were statistically identical in winter transformed and untransformed seeds. However, in transformants designated KQ012, lysine levels were statistically increased in the transformants and leucine levels were statistically significantly reduced in the transformants. Thus, the Z27 promoter-Z4 sense transformant has a seed shape, protein and amino acid composition phenotype similar to that found in antisense transformants. This appears to result from homology-dependent gene silencing. To demonstrate that homology-based gene silencing does not occur when the corn Z27 promoter is replaced by the Coix promoter of the homologous Coix gene, a plasmid vector is constructed that constructs in the Coix gene homologous to the Z27 gene. It consists of a separate promoter. This promoter is linked to Zea mays Z4 coding sequence. Promoter sequences were isolated using the strategy described in Example 1. Coix-promoter-Z4 coding sequence is then transduced with corn as described above. As described above, a transformed plant comprising the vector is generated and hybridized with the untransformed homolog. The amount of α-Zane was then measured to explain that there was no decrease in exogenous gene expression in the transformants comprised of Coix-derived promoter-Z4 Savior gene expression cassette. In addition, the increased expression of the Coix-derived promoter-Z4 structural gene expression cassette for transformants comprising native promoters is explained by the absence of an opaque phenotype in plants with Coix-derived promoter-Z4 structural gene expression cassettes. Analysis of lysine and leucine concentrations in Coix-derived promoter-Z4 structural gene expression cassette transformants may explain that lysine levels did not increase and leucine levels did not decrease, using the corn Z27 promoter. Likewise, no sense-co-inhibition was observed in maize transformants consisting of promoters derived from Coix. Example 9 Transformation of H99 Immature Embryo or Callus and Screening with Paromomycin Corn immature pears (1.2-3.0 mm long, 10-14 days after pollination) are isolated from H99 plants grown in self- or inbred greenhouses. Immature embryos are cultured at 27 ° C. on 735 medium in the dark. Immature embryos are bombarded 1 to 6 days after isolation or cultured to make embryonic callus tissue used for shelling. Embryonic callus is extended and maintained in secondary culture with fresh 735 medium every two to three weeks. Embryos or embryogenic callus tissues (divided into lumps of about 2-4 mm) cultured before bombardment are transferred on 735 medium containing 12% sucrose for 3-6 hours. After shelling as described in Example 6, the tissue culture was incubated overnight and transferred to 735 medium containing 500 mg / l paromomycin. After 2-3 weeks, the callus is divided into small pieces (2-4 mm in diameter) and transferred to fresh selection medium. This secondary culture step is repeated for up to 15 weeks at intervals of 2-3 weeks. If the secondary culture is continued, healthy growth unions can be visually selected. The paromomycin-resistant callus was free of 2,4-D but transferred to 735 medium containing 3.52 mg / lBAP, grown at 27 ° C in the dark for 3-9 days, and then 100 mg / l paromomycin / Phytatrays. (Sigma) to 110 medium ((1 / 2X MS salt, 0.5 mg / l thiamine, 0.5 mg / l nicotinic acid, 3% sucrose, 3.6 g / l Gelgro, pH 5.8) followed by 27 ° C. providing light After 3-6 weeks, the plants from Phytatrays are transferred to the soil, which adapts to the growing room, grows in the greenhouse and matures. Example 10 Expression of GUS Reporter Gene Under Gamma Coicin Promoter Control Standard Histochemical GUS Activity Staining 1) Compounding the stock solution for GUS assay buffer; 1 ml of ferricyanide potassium 50 mM stock 1 ml of ferricyanide potassium 50 mM stock Sodium Phosphate Buffer 200 mM stock, pH 7.0 1ml EDTA sodium 10 mM stock, pH 8.0 1ml Triton X-100 10% v / v stock 1ml 2) Filter sterilize the test buffer mixture through a 0.2 micron filter. 3) The chromogenic substrate is X-gluc (5-bromo-4-chloro-3-indolyl-beta-D-glucuronide) dissolved in N, N-dimethylformamide at a concentration of 25 mg / ml. 4) Combine the following reagents to prepare a working GUS test solution. Sodium Phosphate Buffer 200mM, pH 7.0 26ml 9 ml GUS test buffer (from step 1) 25mg / ml stock 1.2ml 5) Incubate the tissue in the GUS test mixture at 37 ° C. Blue tissue appears in tissues containing GUS enzyme activity. Tissue is incubated overnight at room temperature or longer. GUS gene expression was examined in the grains obtained from the transformed plants described in Example 7. Grain was obtained from individual R0 transformed plants about 9 days after pollination (DAP) via 27DAP. Grain slices are placed in wells of a 24-well microtiter dish and incubated in GUS test solution at room temperature according to the method described by Jefferson (Jefferson, R.A., 1987). The blue color showing GUS activity is recorded at levels 0-4 (0 is no blue coloration; 4 is the strongest coloration) Among the plants, blue coloration was observed by examining the RO stage for GUS expression in the grains, in the case of the GcxPro (900) / GUS / NOS construct in five out of nine plants; For GcxPro (900) / rActin1 / GUS / NOS constructs in four out of nine plants; In the case of the GcxPro (400) / rActin1 / GUS / NOS construct in three out of twelve plants; In the case of the GcxPro (220) / rActin1 / GUS / NOS construct, blue coloration was observed in two of the six plants (Table 11). No plants showed any blue coloration in the grains in the tested plants containing the GcxPro (400) / GUS / NOS or GcxPro (220) / GUS / NOS constructs. Spatial coloring patterns can be observed for blue coloring in other parts of the grain. In the kernels of GcxPro (900) / GUS / NOS plants, expression patterns appeared only in the endosperm, mostly in the starch endosperm, and in some grains, the coloring was limited to the whistle; In the kernels of GcxPro (900) / rActin1 / GUS / NOS plants, the pattern of pigmentation appears mainly in the starch embryo, and in some embryos the light-restricted pigmentation appears, and GcxPro (400) / rActin1 / GUS / NOS or GcxPro (220) / Grains from rActin1 / GUS / NOS plants show pigmentation in both endosperm and pear, indicating that the endosperm-specific expression pattern was lost. No blue coloration was detected in the grains obtained from GcxPro (400) / GUS / NOS or GcxPro (220) / GUS / NOS plants. Plants expressing GcxPro (900) / GUS / NOS or GcxPro (900) / rActin1 / GUS / NOS transgenic genes show a temporarily controlled coloring pattern, with older seeds colored more blue than young seeds ( Table 12). Table 11 Table 12a Table 12b Example 11 General method for bombarding microprojectiles Many variables in the techniques used to bombard microprojectiles are known to those skilled in the art and are believed to be useful in the present invention. The general procedure of shelling is described in PCT application WO 95/06128. Examples of target tissues used in the present invention include immature embryos, Tpye I union, Tpye II union, Tpye III union, suspension culture, meristem (PCT Application WO 96/04392) and the like. Some genotypes that are particularly useful for maize transformation have been characterized (WO 95/06128). Appropriate genotypes can be transformed immediately and regenerated to produce transformed plants that can be fertilized. Microprojection acceleration Any method can be used to transform plant cells in accordance with the present invention. A suitable method is a particle gun operated by a gas such as the DuPont Biolistics PDS1000He particle bomber. Examples of the particles to bombard include tungsten, gold, platinum, and the like. Gold particles are particularly useful in the present invention, with 0.6 μm or 0.7 μm gold particles being preferred, with 0.6 μm gold particles being most suitable. The most suitable particles are DNA coated and have an average size of 0.6 μm to 1.0 μm. As described herein, any DNA sequence can be used for transformation. DNA fragments used for transformation include one or more selectable, secretable or screenable markers. Many examples of such are known and described herein. In the case of selectable markers, the selection is in a solid or liquid medium. The DNA fragments used include one or more genes that can give the transformed plant the desired phenotype, either individually or in combination with other sequences. The corresponding phenotypes to which the genes and sequences for transformation are assigned to the transformed plants are described herein. Example 12 Genetic introduction and hybrid as excellent homologous Backcrossing can be used to improve the starting plant. Backcrossing can transfer certain desirable traits from one source to a cognate propagation or other plant lacking such traits. For example, a good cognate propagule (A) (regenerating parent) is first hybridized to a donor cognate (non regenerative parent) carrying a construct prepared according to the present invention, having the appropriate gene for the trait in question. Conduct. The offspring of this cross are first selected from offspring generated for the desired traits transferred from the non- regenerative parent, and then the selected offspring are paired with the superior regenerative parent (A). After five or more backcrosses, the generation progeny screened for the desired trait are semi-conjugated to positions that control the characteristics delivered, but are excellent parents for almost all other genes. The last backcross generation must self-pollinate at least once to provide offspring with pure seed for the gene to be delivered. Thus, through a series of breed improvement manipulations, selected foreign transgenes are transferred from one state to another completely, without the need for further recombination manipulations. Introduced genes are generally valuable when genetically acting as any other gene, which can be manipulated by breeding techniques in the same way as any other grain gene. By crossing different cognate plants, a large number of different hybrids with different foreign gene complexes can be produced. In this way, plants can be made that have the desired agricultural properties associated with the hybrid (“hybrid growth”) and that have the desired properties conferred by one or more transgenic genes. Example 13 Screening Supported by Markers Genetic markers can be used to assist in introducing one or more foreign genes of the invention from one genetic background to another. Marker-assisted screening can have advantages over conventional breeding, which avoids errors due to phenotypic changes. Genetic markers also provide data on the relative degree of good germ plasm in individual offspring of a particular cross. For example, in the case of crossing a plant of a desired trait with a non-agronomically desirable genetic background with a good parent, gene markers may be used to identify offspring with relatively high desired germ plasm with the trait of interest. Can be screened. In this way, the number of generations required to introduce one or more traits into a particular genetic background can be minimized. In the course of marker assisted breeding, DNA sequences can be used to bring about the desired agronomic traits (Tanksley et al., 1989). Carry out marker-assisted breeding as follows: Seed the plants with the desired traits into the soil in the greenhouse or field. The leaf tissue is harvested from the plant to prepare DNA at any growth point, and about 1 g of leaf tissue is recovered from the plant without damaging the plant's viability. Genomic DNA was isolated by modifying the procedure described in Shure et al. (1983). Approximately 1 g of leaf tissue of the seedlings is frozen in a 15 ml polypropylene tube overnight. Freeze-dried tissue is ground in a tube using a glass rod. Powdered tissue is thoroughly mixed in 3 ml extraction buffer (7.0 urea, 0.35 M NaCl, 0.05 M Tris-HCl pH 8.0, 0.01 M EDTA, 1% sarcosine). Tissue / buffer homogenate is extracted with 3 ml phenol / chloroform. The aqueous phase was separated by centrifugation and precipitated twice with 1/10 volume of 4.4M acetate ammonium (pH5.2) and the same amount of isopropanol. The precipitate was washed with 75% ethanol and 100-500 μl TE (0.01 M Tris-HCl, 0.001 M EDTA, pH 8.0) Genomic DNA was treated with 3x excess restriction enzyme, electrophoresed through 0.8% agarose (FMC) and transferred to Schycher and Schuell (Nytran) (Southern, 1975), where 10X SCP (20 SCP: 2M NaCl, 0.6 M EDTA disodium) is used. Filters were prehybridized with 32 P-labeled probes made by 0.02M 6X SCP, 10% dextran sulfide, 2% sarcosine, 500 μg / ml denatured salmon sperm DNA, random priming (Feinberg & Vogelstein, 1983). . Hybridized filters are washed with 2X SCP, 1% SDS at 65 ° C. for 30 minutes, and self-radiographed using Kodak XAR5 film. Genetic polymorphisms genetically linked to a desired trait can be used to predict the presence or absence of a desired trait. Those skilled in the art will appreciate that there are many different ways to separate DNA from plant tissue, and there are many different protocols for hybrid reactions to produce the same result. Those skilled in the art will appreciate that after autoradiography, the radioactive probe can be removed with a sudden blot and probed back with a different probe. In this way it is possible to identify each of the various foreign introduction genes in the plant. Those skilled in the art will also recognize the presence of a trait using any gene marker that is polymorphic in the desired portion, and will recognize that such information may be used for breeding that is supported by the marker. Each line of the Southern blot represents DNA isolated from a plant. The insertion process composition of each plant can be determined using multiple gene insertion procedures as probes on the same genomic DNA blot. Correlation can be established between the contribution of specific insertion processes to the phenotype of plants. Only plants that contain the desired complex insertion process mature and are used for moisture. DNA probes corresponding to specific foreign gene insertion processes can be useful markers during plant breeding to identify and combine specific insertions without growing the plants and without having to examine the plants for farming. Genomic DNA may be cleaved once or in combination using one or more restriction enzymes. Those skilled in the art will appreciate that many other restriction enzymes are useful and that restriction screening depends on the DNA sequence of the foreign gene insertion process available as a probe and the DNA sequence in the genome around the foreign gene. In the case of probes, DNA or RNA sequences that hybridize to the DNA used for transformation can be used. Restriction enzymes that produce DNA fragments are screened after hybridization, which can be identified by foreign gene insertion. Thus, certain useful restriction enzymes will exhibit polymorphisms genetically linked to the desired trait or specific foreign transgene. Example 14 General inspection method. DNA analysis of the transformed plants was performed as follows. Genomic DNA can be isolated by modifying the process described in Shure, et al., 1983. About 1 mg of callus or leaf tissue is ground to form a micropowder under liquefied nitrogen, using molar and mortar. The powdered tissue is mixed with 4 ml extraction buffer (7.0 M urea, 0.35 M NaCl, 0.05 M Tris-HCl pH 8.0, 0.01 M EDTA, 1%). Tissue / buffer homogenate was extracted with 4 ml phenol / chloroform. The aqueous phase is separated by centrifugation, passed through Miracloth and precipitated twice with 1/10 volume of 4.4M acetate ammonium (pH5.2), equal amount of isopropanol. The precipitate is washed with 70% ethanol and resuspended in 200-500 mL TE (0.01 M Tris-HCl, 0.001 M EDTA, pH 8.0). The presence of DNA sequences in the transformed cells can be detected using polymerase chain chain reaction (PCR). Using this technique, specific DNA fragments can be amplified and detected after agarose gel electrophoresis. For example, 200-1000 ng genomic DNA was added to the reaction mixture (10 mM Tris-HCl pH 8.3, 1.5 mM MgCl 2 , 50 mM KCl, 0.1 mg / ml gelatin, 200 μM each dATP, dCTP, dGTP, dTTP, 0.5 μM forward and reverse) DNA primer, 20% glycerol, 2.5 unit Taq DNA polymerase). The reaction is carried out using a heat cycle machine as follows; 3 minutes at 94 ° C, 1 minute at 94 ° C, 1 minute at 5oeh, 39 cycles of 30 seconds at 72 ° C, followed by 5 minutes at 72 ° C. 20 μl of each reaction mixture is run at 50 V using TBE buffer (90 mM Tris-borate, 2 mM EDTA) in a 3.5% NuSieve gel. Using this procedure, forward primers CATCGAGACAAGCACGGTCAACTTC (SEQ ID NO: 20) and reverse primers AAGTCCCTGGAGGCACAGGGCTTCAAGA (SEQ ID NO: 21) can be used to detect the presence of the bar gene. A method of detecting the presence of phosphinothricin acetyl transferase (PAT) is by using in vitro enzyme reactions and TLC (described in WO 95/06128). This process is performed by homogenization of transformed cells and various protein extracts from reference cells that have not been transformed or exposed to non-alcohol selection, incubated with PPT and 14 C-acetyl Coenyme A, and TLC. The test results confirm that the expression of the bar gene encoding PAT is confirmed. For Southern blot analysis, genomic DNA was treated with 3x excess restriction enzyme, electrophoresed through 0.8% agarose (FMC), and 20X SCP (20X SCP: 2M NaCl, 0.6M) with Nytran (Schleicher and Schuell). Sodium phosphate, 0.02 M EDTA disodium). The probe is labeled with 32 P, using a random priming method (Boehringer Mannheim). And Quik-Sep Purification was performed using a spin column (Isolab Inc., Akron, OH). Filters were prehybridized at 65 ° C. for 15 minutes in 6 × SCP, 10% dextran sulfide, 2% sarcosine, 500 μg / ml heparin (Chomet et al., 1987). The filter is then hybridized overnight at 6 ° C. at 6 ° C. (100 μg / ml denatured salmon sperm DNA, including 32 P-labeled probes). The filter is washed for 30 minutes at 65 ° C. in 2X SCP, 1% SDS, and self-radiographed using Kodak XAR5 film. For the rehybrid reaction, the filter is heated in distilled H 2 O for 10 minutes to remove the first probe and prehybridize as described above. Example 15 Use of Transformed Grains The ultimate goal of plant transformation is to make plants useful for humans. In this regard, transformed plants created according to the present invention can be used for those deemed valuable to producers or consumers. For example, one may wish to harvest seeds from transformed plants. This seed can be used again for a variety of purposes. Seeds can be sold to farmers to grow plants in the field or marketed directly as food to animals or humans. Alternatively, the product can be made from the seed itself. Products that can be made from seeds include oils, starches, animal and human food, pharmaceuticals and various industrial products. In addition to human consumption of corn kernels, edible corn includes the dry and wet milling industries. The main products of maize dry milling are wheat, coarse flour and wheat flour. Corn's wet-milling industry can provide corn starch, corn syrup and edible dextrose. Corn oil can be recovered from the corn pears, which are by-products of the dry and wet-milling industries. Corn, including the cereal and non-grain portions of plants, is widely used as feed for livestock, mainly food for cattle, dairy cows, pigs or poultry. The industrial use of corn is to produce ethanol and corn starch in the wet-milling industry and to provide corn flour in the dry-milling industry. Industrial uses of corn starch and wheat flour are based on functional properties such as viscosity, film formation, adhesion, ability to suspend particles, and the like. Corn starch and wheatgrass are also available in the paper and textile industries. Other industrial uses include adhesives, building materials, casting combinations, laundry starch, explosives, oil well muds, and other mining applications. Other parts than corn kernels can also be used in industry, for example, corn stalks and shells to make paper, wallboard, and corn cobs for fuel or charcoal. Other means of using the plants available in the present invention are also known and will be readily appreciated by those skilled in the art from the specification of the present invention. Specific methods of using grains are well described in Sprague and Dudley (1988) and Watson and Ramstad (1987). All compositions and methods described herein can be made and executed without undue experimentation based on the disclosure herein. The compositions and methods of the present invention have been described in suitable embodiments and will enable those skilled in the art to make various changes in steps or order of the invention without departing from the scope of the invention. In particular, the materials described herein may achieve similar or identical results by substituting certain materials that are chemically and physiologically related. Related literature Abel et al., Science, 232: 738-743, 1986. Araki et al., "Site-specific recombinase, R, encoded by yeast plasmid pSR1," J. Mol. Biol. 225 (1): 25-37, 1992. Armstrong et al., Maize Genetics Coop Newsletter, 65: 92-93, 1991. Assad, Tucker, Signer, "Epigenetic repeat-induced gene silencing (RIGS) in Arabidopsis," Plant Mol. Biol., 22: 1067-85, 1993. Bansal, Viret, Haley, Khan, Schantz, Bogorad, "Transient expression from cab-m1 and rbcS-m3 promoter sequence is different in mesophyII and bundle sheath cells in maize leaves," Proc. Natl. Acad. Sci. USA, 89: 3654-3658, 1992. Barkai-Golan et al., Arch. Microbiol., 116: 119-124, 1978. Barton et al., Plant Physiol., 85: 1103-1109, 1987. Bates, "Genetic transformation of plants by protoplast electroporation," Mol Biotechnol., 2 (2): 135-145, 1994. Battraw and Hall, "Stable transformation of sorghum-bicolor protoplasts with chimeric neomycin phosphotransferase II and beta glucuronidase genes," Theor. App. Genet., 82 (2): 161-168, 1991. Batrraw and Hall, "Stable transformation of sorghum-bicolor protoplasts with chimeric neomycin phosphotransferase ii and beta glucuronidase genes," Theor. Appl. Genet., 82 (2): 161-168, 1991. Belanger and Kriz, "Molecular basis for allelic polymorphism of the maize globulin-1 gene," Genet., 129: 863-872, 1991. Bellus, J. Macromol. Sci. Pure Appl. Chem., A 31 (1): 1355-1376, 1994. Bernal-Lugo and Leopold, Plant Physiol., 98: 1207-1210, 1992. Bevan et al., "Structure and transcription of the nopaline synthase gene region of T-DNA," Nucleic Acids Research, 11 (2): 369-385, 1983. Bhattacharjee; An; Gupta, "Fertile transgenic indica rice produced by expression of maize ubiquitin promoter-bar chimeric gene in the protoplasts," J. Plant Bioch. and Biotech. 6, (2): 69-73. 1997. Blackman et al., Plant Physiol., 100: 225-230, 1992. Bol et al., Annu. Rev. Phytopath., 28: 113-138, 1990. Bouchez et al., EMBO Journal, 8 (13): 4197-4204, 1989. Bower et al., "Transgenic Sugarcane Plants vis Microprojectile Bombardment," The Plant Journal, 2: 409-416. 1992. Bowler et al., Ann Rev. Plant Physiol., 43: 83-116, 1992. Branson and Guss, Proceedings North Central Branch Entomological Society of America, 27: 91-95, 1972. Broakaert et al., Science, 245: 1100-1102,1989. Buising and Benbow, "Molecular analysis of transgenic plants generated by microprojectile bombardment: effect of petunia transformation booster sequence," Mol Gen Genet, 243 (1): 71-81. 1994. Callis et al., "Introns increase gene expression in cultured maize cells," Genes and Development, 1: 1183-1200, 1987. Campbell (ed.), In: Avermectin and Abamectin, 1989. Capaldi et al., Biochem. Biophys. Res. Comm., 76: 425,1977. Casas, Kononowicz, Zehr, Tomes, Axtell, Butler, Bressan, Hasegawa, "Transgenic sorghum plants via microprojectile bombardment," Proc. Natl. Acad. Sci. USA, 90 (23): 11212-11216, 1993. Chandler et al., "Two Regulatory Genes of the Maize Anthocyanin Pathway Are Homologous: Isolation of B Utilizing R Genomic Sequences," The Plant Cell, 1: 1175-1183, 1989. Chau et al., Science, 244: 174-181, 1989. Chomet et al., EMBO J., 6: 295-302, 1987. Christou; Murphy; Swain, "Stable transformation of soybean by electroporation and root formation from transformed callus," Proc. Natl. Acad. Sci. U S A, 84 (12): 3962-3966, 1987. Chu et al., Scientia Sinica, 18: 659-668, 1975. Coe et al., In: Corn and Corn Improvement, 81-258, 1988. Conkling et al., Plant Physiol., 93: 1203-1211, 1990. Consonni, Geuna, Gavazzi, Tonelli, "Molecular homology among members of the R gene family in maize," Plant J., 3 (2): 335-346, 1993. Cordero, Raventos, San Segundo, "Expression of a maize proteinase inhibitor gene is induced in response to wounding and fungal infection: systemic wound-response of a monocot gene," Plant J., 6 (2) 141-150, 1994. Coxson et al., Biotropica, 24: 121-133, 1992. Cristou et al., Plant Physiol., 87: 671-674, 1988. Cuozzo et al., Bio / Technology, 6: 549-553, 1988. Cutler et al., J. Plant Physiol., 135: 351-354, 1989. Czapla and Lang, J. Econ. Entomol., 83: 2480-2485, 1990. Davies et al., Plant Physiol., 93: 588-595, 1990. De Block, Botterman, Vandewiele, Dockx, Thoen, Gossel Movva, Thompson, Van Mantagu, Leemans, "Engineering herbicide resistance in plants by expression of a detozifying enzyme," The EMBO Journal, 6 (9): 2513-2518, 1987. De Block, De Brouwer, Tenning, "Transformation of Brassica napus and Brassica oleracea Using Agrobacterium tumefaciens and the Expression of the bar and neo Genes in the Transgenic Plants," Plant Physiol., 91: 694-701, 1989. Dehio and Schell, "Identification of plant genetic loci involved in a posttranscriptional mechanism for meiotically reversible transgene silencing," Proc. Natl., Acad. Sci. USA, 91: 5538-5542, 1994. Dellaporta et al., "A plant DNA minipreparation: version II," Plant Nol. Biol. Rep., 1: 19-21, 1983. Dellaporta et al., In: Chromosome Structure and Function: Impact of New Concepts, 18th Stadler Genetics Symposium, 11: 263-282, 1988. Dennis, Gerlach, Pryor, Bennetzen, Inglis, Llewellyn, Sachs, Ferl, Peacock, "Molecular analysis of the alcohol detydrogenase (Adh1) gene of maize," Nucl. Acids Res., 12 (9) 3983-4000, 1984. Depicker et al., Plant Cell Reports, 7: 63-66, 1988. D'Halluin, K., Bonne, E., Bossut, M. De Beuckeleer, M., and Leemans, J. The Plant Cell 4: 1495-1505. 1992. Dhir; Dhir; Savka; Belanger; Kriz; Farrand; Widholm, "Regeneration of transgenic soybean glycine-max plants from electroporated protoplasts," Plant Physiol, 99 (1) 81-88, 1992. Dunn et al., Can. J. Plant Sci., 61: 583, 1981. Dure et al., Plant Molecular Biology, 12: 475-486, 1989. Ellis et al., EMBO Journal, 6 (11): 3203-3208, 1987. Enomoto M, et al., "Mapping of the pin locus coding for a site-specific recombinase that causes flagellar-phase variation in Escherichia coli K-12," J Bacteriol., 6 (2): 663-668. 1983. Erdmann et al., J. Gen. Microbiology, 138: 363-368, 1992. Feinberg and Vogelstein, Anal. Biochem., 132: 6-13. 1983. Finkel et al., Plant Sci., 42: 133-140, 1985. Fitzpatrick, "Pleiotropic Gene Found in Barley Plant," Genetic Engineering News, 13 (5): 1,22, 1993. Fitzpatrick, Gen. Engineering News, 22: 7, 1993. Fodor et al., "Light-directed, spatially addressable parallel chemical synthesis," Science, 251: 767-773, 1991. Franken, Niesbach-Klosgen, Weydemann, Marechal-Drouard, Saedler, Wienand, "The duplicated chalcone synthase genes C2 and Whp (white pollen) of Zea mays are independently regulated; evidence for translational control of Whp expression by the anthocyanin gene," EMBO J., 10 (9) 2605-2612, 1991. Fransz, de Ruijter, Schel, "Isoenzymes as Biochemical and Cytochemical Markers in Embryogenic Callus of Maize (Zea mays L.)," Plant Cell Reports, 8: 67-70, 1989. Freifelder, In: Physical Biochemistry Applications to Biochemistry and Molecular Biology, 2nd ed., 1982. Frohman, In: PCR TM Protocols: A Guide to Methods and Applications, 1990. Fromm et al., The Plant Cell, 1: 977-984, 1989. Gallie et al., The Plnat Cell, 1: 301-311, 1989. Gatehouse et al., J. Sci. Food. Agric., 35: 373-380, 1984. Gelvin et al., In: Plant Molecular Biology Manual, 1990. Ghosh-Biswas, Iglesias, Datta, Potrykus, "Transgenic Indica rice (Oryza sativa L.) plants obtained by direct gene transfer to protoplasts," J. Biotechnol., 32 (1): 1-10, 1994. Golic and Lindquist, Cell, 59: 3, 499-509. 1989. Goring et al., Proc. Natl. Acad. Sci. USA, 88: 1770-1774, 1991. Grosset, Alary, Gautier, Menossi, Martinez-Izquierdo, Joudrier, "Characterization of a barley gene coding for an alpha-amylase inhibitor subunit (CMd protein) and analysis of its promoter in transgenic tobacco plants and in maize kernels by microprojectile bombardment," Plant Mol. Biol., 34 (2): 331-338, 1997. Guerrero et al., Plant Molecular Biology, 15: 11-26, 1990. Gupta et al., Proc. Natl., Acad. Sci. USA, 90: 1629-1633, 1993. Hacia et al., "Detection of heterozygous mutations in BRCA1 using high density oligonucleotide arrays and two-colour fluorescence analysis," Nature Genetics, 14: 441-447, 1996. Hagio, Blowers, Earle, "Stable transformation of sorghum cell cultures after bombardment with DNA coated microprojectiles," Plant Cell Rep., 10 (5): 260-264, 1991. Hamilton et al., Proc. Nat. Acad. Sci. USA, 93 (18): 9975-9979, 1996. Hammock et al., Nature, 344: 458-461, 1990. Haseloff, Siemering, Prasher, Hodge, "Removal of a cryptic intron and subcellular localization of green fluorescent protein are required to mark transgenic Arabidopsis plants brightly," Proc. Natl. Acad. Sci., USA, 94: 2122-2127, 1997. He; Mouradov; Yang; Mouradova; Scott, "Transformation of wheat (Triticum aestivum L.) through electroporation of protoplasts," Plant Cell Reports, 14 (2-3): 192-196, 1994. Hemenway et al., The EMBO J., 7: 1273-1280, 1988. Hensgens, de Bakker, van Os-Ruygrok, Rueb, van de Mark, van der Maas, van der Veen, Kooman-Gersmann, Schilperoort, "Transient and stable expression of gusA fusions with rice genes in rice, barley and perennial ryegrass," Plant Mol. Biol., 22 (6): 1101-1127, 1993. Hilder et al., Nature, 330: 160-163, 1987. Hinchee et al., Bio / technol., 6: 915-922, 1988. Hou and Lin, "Rapid optimization of electroporation conditions for soybean and Hudspeth and Grula, Plant Mol. Biol., 12: 579-589, 1989. Hou and Lin, Plant Physiology, 111: 166. 1996. Ikeda et al., J. Bacteriol., 169: 5615-5621, 1987. Ikuta et al., Bio / technol., 8: 241-242, 1990. Ingelbrecht, Van Houdt, Van Montagu, Depicker, "Post-transcriptional silencing of reporter transgenes in tobacco correlates with DNA methylation," Proc. Natl., Acad. Sci. USA, 91: 10502-10506, 1994. Jefferson, "Assaying chimeric gens in plants; the GUS fusio system," Plant Molecular Biology Reporter 5: 387-405, 1987. Johnson et al., Proc. Natl. Acad. Sci. USA, 86: 9871-9875, 1989. Jorgensen, "Altered gene expression in plants due to trans interactions between homologous genes," Trends Biotechnol., 8: 340-44, 1990. Jorgensen, "Cosuppression, flower color patterns, and metastable gene expression states," Science, 268: 686-691, 1995. Joshi, Nucleic Acids Res., 15: 6643-6653, 1987. Kaasen et al., J. Bacteriology, 174: 889-898, 1992. Kaeppler et al., Plant Cell Reports 9: 415-418, 1990. Kaeppler, Somers, Rines, Cockburn, "Silicon carbide fiber-mediated stable transformation of plant cells," Theor. Appl. Genet., 84 (5-6): 560-566, 1992. Karsten et al., Botanica Marina, 35: 11-19, 1992. Katz et al., J. Gen. Microbiol., 129: 2703-2714, 1983. Keller et al., EMBO J., 8 (5): 1309-1314, 1989. Klein, Kornstein, Sanford, Fromm, "Genetic Transformation of Maize Cells by Particle Bombardment," Plant Physiology, 91: 440-444, 1989. Knittel, Gruber; Hahne; Lenee, "Transformation of sunflower (Helianthus annuus L.): A reliable protocol," Plant Cell Reports, 14 (2-3): 81-86, 1984. Kohler, Liaud, Mendel, Cerff, Hehl, "The maize GapC4 promoter confers anaerobic reporter gene expression and shows homology to the maize anthocyanin regulatory locus C1," Plant Mol. Biol., 29 (6): 1293-1298, 1995. Koster and Leopold, Plant Physiol., 88: 829-832, 1988. Kriz, Boston, Larkins, "Structural and transcriptional analysis of DNA sequences flanking genes that encode 19 kilodalton zeins," Mol. Gen. Genet., 207 (1): 90-98, 1987. Kunkel, T.A. et al., "Rapid and efficient site-specific mutagenesis without phenotypic selection," Methods Enzymol, 154: 367-382, 1987. Kwoh et al., Proc. Natl. Acad. Sci. USA, 86: 1173, 1989. Langridge and Feix, "A zein gene of maize is transcribed from two widely separated promoter regions," Cell, 34: 1015-1022, 1983. Laufs et al., Proc. Natl. Acad. Sci., 7752-7756, 1990. Lazzeri, "Stable transformation of barley via direct transformation uptake. Electroporation and PEG-mediated protoplast transformation," Methods Mol. Biol., 49: 95-106. 1995. Lee and Saier, J. of Bacteriol., 153-685, 1983. Lee, Shu; Lee, "Gene transfer into intact cells of tobacco by electroporation," Korean J Genet, 11 (2): 65-72, 1989. Levings, Science, 250: 942-947, 1990. Lindbo, Silva-Rosales, Proebsting, Dougherty, "Induction of a highly specific antiviral state in transgenic plants; implications for gene regulation and virus resistance," Plant Cell, 5: 1749-1759, 1993. Lindstrom et al., Developmental Genetics, 11: 160, 1990. Loomis et al., J. Expt. Zoology, 252: 9-15, 1989. Ma et al., Nature, 334: 631-633, 1988. Maas, Reichel, Schell, Steinbiss, "Preparation and transformation of monocot protoplasts," Methods Cell Biol., 50: 383-399, 1995. Maeser et al, "The Gin recombinase of phage Mu can catalyse site-specific recombination in plant protoplasts," Mol Gen Genet., 230 (1-2): 170-176, 1991. Mariani et al., Nature, 347: 737-741, 1990. Martinez, Martin, Cerff, "Structure, evolution and anaerobic regulation of a nuclear gene encoding cytosolic glyceraldehyde-3-phosphate dehydrogenase from maize," J. Mol. Biol., 208 (4): 551-565, 1989. Matzke and Matzke, "How and why do plants inactivate homologous (trans) genes ," Plant Physiol., 107: 679-685, 1995. Matzke, Neuhuber, Matzke, "A variety of epistatic interactions can occur between partially homologous transgene loci brought together by sexual crossing," Mol. Gen. Genet., 236: 379-86, 1993. Matzke, Neuhuber, Park, Ambros, Matzke, "Homology-dependent gene silencing in transgenic plants: epistatic silencing loci contain multiple copies of methylated transgenes," Mol. Gen. Genet., 244: 219-229, 1994. Matzke, Priming, Trnovsky, Matzke, "Reversible methylation and inactivation of marker genes in sequentially transformed tobacco plants," EMBO J., 8: 643-49, 1989. Meyer, "Understanding and controlling transgene expression," Trends Biotechnol., 13: 332-337, 1995. Meyer, Heidmann, Niedenhof, "Differences in DNA-methylation are associated with a paramutation phenomenon in transgenic petunia," Plant J., 4: 86-100, 1993. Mittlesten, Scheid, Paszkowski, Potrykus, "Reversible inactivation of a transgene in Arabidopsis thaliana," Mol. Gen. Genet., 228: 104-12, 1991. Mueller, Gilbert, Davenport, Birgnetic, Baulcombe, "Homology-dependent resistance transgenic virus resistance in plants to homology-dependent gene silencing," Plant J., 7: 1001-1013, 1995. Mundy and Chua, The EMBO J., 7: 2279-2286, 1988. Murakami, Anzai, Imai, Satoh, Nagaoka, Thompson, "The bialaphos biosynthetic genes of Streptomices tygroscopicus: Molecular cloning and characterization of the gene cluster," Mol. Gen. Genet., 205: 42-50, 1986. Murashige and Skoog, Physiol. Plant., 15: 473-497, 1962. Murdock et al., Phytochemistry, 29: 85-89, 1990. Murray et al., Nucleic Acids Research 17: 477-498, 1989. Nagatani, Honda, Shimada, Kobayashi, "DNA delivery into rice cells and transformation using silicon carbide whiskers," Biotech. Tech., 11 (7): 471-473, 1997. Napoli, Lemieux, Jorgensen, "Introduction of a chimeric chalcone synthase gene into petunia results in reversible co-suppression of homologous genes in trans," Plant Cell, 2: 279-289, 1990. Neuhuber, Park, Matzke, Matzke, "Susceptibility of transgene loci to homology-dependent gene silencing," Mol. Gen. Genet., 244: 230-241, 1994. Newton, Winberg, Yamato, Lupold, Stern, "Evidence for a novel motochondrial preceding the cox2 gene of perennial teosintes," EMBO J., 14 (3): 585-593, 1995. Niebel, Frendo, Van Montagu, Cornelissen, "Post-transcriptional cosuppression of β-1,3-glucanase genes does not affect accumulation of transgene nuclear mRNA," Plant Cell, 7: 347-358, 1995. Odell et al., "Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter," Nature, 313: 810-812, 1985. Ogawa et al., Sci. Rep., 13: 42-48, 1973. Ohara et al., Proc. Natl. Acad. Sci. USA, 86: 5673-5677, 1989. Omirulleh et al., "Activity of a Chimeric Promoter with the Doubled CaMV 35S Enhancer Element in Protoplast-Derived Cells and Transgenic Plants in Maize," Plant Molecular Biology, 21: 415-428, 1993. Omirulleh, Abraham, Golovkin, Stefanov, Karabaev, Mustardy, Morocz, Dudits, "Activity of a chimeric promoter with the doubled CaMV 35S enhancer element in protoplast-derived cells and transgenic plants in maize," Plant Mol. Biol., 21 (3): 415-428, 1993. Ow et al., Science, 234: 856-859, 1986. Park, Papp. Moscone, Iglesias, Vaucheret, Matzke, Matzke, "Gene silencing mediated by promoter homology occurs at the level of transcription and results in meiotically heritable alteraions in methylation and gene activity," Plant, 9: 183-194, 1996. Paul and Ferl, "In vivo footprinting reveals unique cis-elements and different modes of typoxic induction in maize Adh1 and Adh2," Plant Cell, 3 (2): 159-168, 1991. Pease et al., "Light-generated oligonucleotide arrays for rapid DNA sequence analysis," Proc. Natl. Acad. Sci, USA, 91: 5022-5026, 1994. Perlak et al., "Proc. Natl. Acad. Sci. USA, 88: 3324-3328, 1991. Phi-Van et al., Mol. Cell. Biol., 10: 2302-2307, 1990. Piatkowski et al., Plant Physiol., 94: 1682-1688, 1990. Pignon et al., Hum. Mutat., 3: 126-132, 1994. Poszkowski et al., EMBO J., 3: 2719, 1989. Potrykus et al., Mol. Gen. Genet., 199: 183-188, 1985. Prasher et al., Biochem. Biophys. Res. Commun., 126 (3) 1259-1268, 1985. Pros and Meyer, "The methylation patterns of chromosomal integration regions influence gene activity of transferred DNA in Petunia hybrida," Plant J., 2: 465-75, 1992. Quigley, Brinkman, Martin, Cerff, "Strong functional GC pressure in a light-regulated maize gene encoding subunit GAPA of chloroplast glyceraldehyde-3-phosphate dehydrogenase: implications for the evolution of GAPA pseudogenes," J. Mol. Evol., 29 (5): 412-421, 1989. Radicella, Turks, Chandler, "Cloning and nucleotide sequence of a cDNA encoding B-Peru, a regulatory protein of the anthocyanin pathway in amize," Plant Mol. Biol., 17 (1): 127-130, 1991. Ralston, English, Dooner, "Sequence of three bronze alleles of maize and correlation with the genetic fine structure," Genet., 119 (1): 185-197, 1988. Reed et al., J. Gen. Microbiology, 130: 1-4, 1984. Reichel, Mathur, Eckes, Langenkemper, Koncz, Schell, Reiss, Maas, "Enhanced green fluorescence by the expression of an Aequorea victoria green fluorescent protein mutant in mono- and dicotyledonous plant cells," Proc. Natl. Acad. Sci., USA, 93: 5888-5893, 1996. Reina, Ponte, Guillen, Boronat, Palau, "Sequence analysis of a genomic clone encoding a Zc2 protein from Zea mays W64 A," Nucl. Acids Res., 18 (21): 6426, 1990. Rensburg et al., J. Plant Physiol., 141: 188-194, 1993. Rhodes; Marrs; Murry, "Transformation of maize by electroporation of embryos," Methods Mol. Biol., 55: 121-131. 1995. Ritala, Aspergren, Kurten, Salmenkallio-Marttila, Mannonen, Hannus, Kauppinen, Teeri, Enari, "Fertile transgenic barley to particle bombardment of immature embryos," Plant Mol. Biol., 24 (2): 317-325, 1994. Rochester, Winer, Shah, "The structure and expression of maize genes encoding the major heat shock protein, hsp70," EMBO J., 5: 451-458, 1996. Sabl and Laird, "Epigene conversion: a proposal with implications for gene mapping in humans," Am. J. Hum. Genet., 50: 1171-1177, 1992. Sambrook, Fritsch, and Maniatis, In Molecular Cloning: A Laboratory Manual, Second edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989. Sauer, Mol. and Cell. Biol., 7: 2087-2096. 1987. Schwaz-Sommer, Shepherd, Tacke, Geirl, Rohde, Leclercq, Mattes, Berndtgen, Peterson, Saedler, "Influence of transposble elements on the structure and function of the A1 gene of Zea mays," EMBO J., 6: 287-294 , 1987. Schwob, Choi, Simmons, Migliaccio, Ilag, Hesse, Palme, Soll, "Molecular analysis of three maize 22 kDa suxin-binding protein genes- transient promoter expression and regulatory regions," Plant J., 4: 423-432, 1993. Shagan and Bar-Zvi, Plant Physiol., 101: 1397-1398, 1993. Sheehy, Kramer, Hiatt, "Reduction of polygalacturonase activity in tomato fruit by antisense RAN," Proc. Natl. Acad. Sci, USA, 85: 8805-8809, 1998. Sheen et al., Plant Journal, 8 (5): 777-784, 1995. Shoemaker et al., "Quantitative phenotypic analysis of yeast deletion mutants using a highly parallel molecular bar-coding strategy," Nature Genetics, 14: 450-456, 1996. Shure et al., Cell, 35: 225-233, 1983. Siebert et al., "An improved PCR method of walking in uncloned genomic DNA," Nucl. Acids Res., 23: 1087-1088, 1995. Simpson, Science, 233: 34, 1986. Singsit, Adang, Lynch, Anderson, Wang, Cardineau, Ozias-Akins, "Expression of a Bacillus thuringiensis cryIA (c) gene in trangenic peanut plants and its efficacy against lesser cornstalk borer," Trangenic Res., 6 (2): 169 -176, 1997. Skriver and Mundy, Plant Cell, 2: 503-512, 1990. Smith, Swaney, Parks, Wernsman, Dougherty, "Trangenic plant virus resistance mediated by untranslatable sense RANs: expressioin, regulation, and fate of nonessential RAN's," Plant Cell, 6: 1441-1453, 1994. Smith, Watson, Bird, Ray, Schuch, Grierson, "Expression of a truncated tomato polygalaturonase gene inhibits expression of the endogenous gene in transgenic plants," Mol. Gen. Genet., 224: 447-481, 1990. Southern, "Detection of specific sequences among DNA fragments separated by gel electrophoresis," J. Mol. Biol., 98: 503-517, 1975. Spencer et al., "Segregation of transgenes in maize," Plant Molecular Biology, 18: 201-210, 1992. Sprague and Dudley, eds., Corn and Improvement, 3rd ed., 1988. Stalker et al., J. Biol. Chem., 263: 6310-6314, 1988. Stalker et al., Science, 242: 419-422, 1988. Stiefel et al., Nature, 341: 343, 1989. Stiefel et al., The Plant Cell, 2: 785-793, 1990. Stougaard, The Plant Journal, 3: 755-761, 1993. Sullivan et al., Mol. Gen. Genet., 215: 431-440, 1989. Sullivan, Christensen, Quail, "Isolation and characterization of a maize chlorophyll a / b binding protein gene that produces high levels of mRAN in the dark," Mol. Gen. Genet., 215 (3): 431-440, 1989. Sutcliffe, "Nucleotide sequence of the ampicillin resistance gene of Escherichia coli plasmid pBR322," Proc. Natl. Acad. Sci. USA, 75: 3737-3741, 1978. Tanksley et al., Bio / Technology, 7: 257-264, 1989. Tarczynski et al., "Expression of a bacterial mtlD gene in transgenic tobacco leads to production and accumulation of mannitol," Proc. Natl. Acad. Sci. USA, 89: 1-5, 1992. Tarczynski et al., "Stree Protetion of Trangenic Tobacco by Production of the Osmolyte Mannitol," Science, 259: 508-510, 1993. Tarczynski et al., Proc. Natl. Acad. Sci. USA, 89: 2600, 1992. Thillet et al., J. Biol. Chem., 263: 12500-12508, 1988. Thompson et al., "Characterization of the herbicide-resistance gene bar from Streptomyces hygroscopicu," The EMBO Journal, 6 (9): 2519-2523, 1987. Tian, Sequin, Charest, "Expression of the green Fluorescent protein gene in conifer tissues," Plant Cell Rep., 16: 267-271, 1997. Tomes et al., "Transgenic tobacco plants and their progeny derived by microprojectile bombardment of tobacco leaves." Plant. Mol. Biol. 14 (2): 261-268, 1990. Tomic et al., Nucl. Acids Res., 12: 1656, 1990. Torbet, Rines, Somers, "Transformation of oat using mature embryo-derived tissue cultures," Crop Science, 38 (1): 226-231, 1998. Torbet, Rines, Somers, "Use of paromomycin as a selective agent for oat transformation," Plant Cell Reports, 14 (10): 635-640, 1995. Tsukada; Kusano; Kitagawa, "Introduction of foreign genes into tomato protoplasts by electroporation," Plant Cell Physio., 30 (4) 599-604, 1989. Twell et al., "Transient Expression of Chimeric Genes Delivered into Pollen by Microprojectile Bombardment," Plant Physiology, 91: 1270-1274, 1989. Ugaki et al., Nucl. Acid Res., 19: 371-377, 1991. Upender et al., Biotechniques, 18: 29-31, 1995. Vaeck. et al., Nature, Vol. 328, P. 33. 1987. Van Blokland, Van der Geest, Mol, Kooter, "Transgene-mediated suppression of chalcone synthase expression in Petunia hybrida results from an increase in RAN turnover," Plant J., 6: 861-877, 1994. Van der Krol, Mur, Beld, Mol, Stuitje, "Flavonoid genes in petunia: addition of a limiting number of copies may lead to a suppression of gene expression," Plant Cell, 2: 291-99, 1990. Van Eck; Blowers; Earle, "Stable transformation of tomato cell cultures after bombardment with plasmid and YAC DNA," Plant Cell Reports, 14 (5): 299-304, 1995. Vasil et al., Plant Physiol., 91: 1575-1579, 1989. Vaucheret, "Identification of a general silencer for 19S and 35s promoters in a transgenic tobacco plant; 90bp of homology in the promoter sequence are sufficient for trans-inactivation," C.R. Acad. Sci. III, 316: 1471-83, 1993. Vernon and Bohnert, The EMBO J., 11: 2077-2085, 1992. Vodkin et al., Cell, 34: 1023, 1983. Vogel et al., J. Cell Biochem., 13D (Supp): 312, 1989. Walker et al., Proc. Natl. Acad. Sci. USA, 84: 6624-6628, 1987. Walker et al., Proc. Natl. Acad. Sci. USA, 89: 392-396, 1992. Wandelt and Feix, "Sequence of a 21 kd zein gene from maize containing an in-frame stop codon," Nucl. Acids Res., 17 (6) 2354, 1989. Wang et al., "CHARACTERIZATION of cis-Actin Elements Regulating Transcription from the Promoter of a Constitutively Active Rice Actin Gene," mOLECULAR and Cellular Biology, 12 (8) 3399-3406, 1992. Watrud et al., In: Engineered Organisms and the Environment, 1985. Watson and Ramstad, eds., Corn: Chemistry and Technology, 1987. Withers and King, Plant Physiol., 64: 675-678, 1979. WOLTER ET al., The EMBO J., 4685-4692, 1992. Wu et al., Genolmics, 4: 560, 1989. Wyn-Jones and Storey, 1982. x IANG and Guerra, Plant Physiol., 102: 287-293, 1993. Yamaguchi-Shinozaki et al., Plant Cell Physiol., 33: 217-224, 1992. Yanagisawa and Izui, "Maize phosphoenolpyruvate carboxylase involved in C4 photosynthesis: nucleotide sequence analysis of the 5 'flankin region of the gene," J. Biochem., 106 (6): 982-987, 1989. Yand and Russell, Proc. Natl. Acad. Sci. USA, 87: 4144-4148, 1990. Zheng and Edwards, "Expression of resistance to barley stripe mosaic virus in barley and oat protoplasts, J. Ge. Virol, 71: 1865-1868, 1990. Zhou; Stiff; Konzak, "Stably transformed callus of wheat by electroporation-induced direct gene transfer" Plant Cell Reports, 12 (11) .612-616, 1993. Zukowsky et al., Proc. Natl. Acad. Sci. USA, 80: 1101-1105.
权利要求:
Claims (63) [1" claim-type="Currently amended] In the method for preparing a monocotyledonous plant other than Coix expressing the selected gene, (a) providing a selected gene; (b) preparing a construct consisting of genes operably linked to a Coix promoter; (c) transforming the recipient cells of the monocotyledonous plant other than Coix with the construct of (b); (d) regenerating monocotyledonous plants expressing the gene selected in the recipient cell. [2" claim-type="Currently amended] The method of claim 1, wherein the monocotyledonous plant is a plant selected from rice, wheat, oats, barley, rye, sugar cane and corn. [3" claim-type="Currently amended] The method of claim 2, wherein the monocotyledonous plant is corn. [4" claim-type="Currently amended] The method of claim 1, wherein the transformation step comprises microprojectile bombardment, PEG mediated plasma transformation, electroporation, silicon carbide fiber mediated transformation, or Agrobacterium-mediated transformation. [5" claim-type="Currently amended] 5. The method of claim 4, wherein the microdroplet bombardment consists of coating the microdropper with DNA consisting of the construct and contacting the recipient cell with the microdropper. [6" claim-type="Currently amended] The gene of claim 1, wherein the selected gene is an insect resistance gene, a fungal disease resistance gene, a viral disease resistance gene, a bacterial disease resistance gene, an insecticide resistance gene, a grain composition or a gene affecting grain quality, a gene using nutrients, A method comprising a gene selected from a fungal toxin reducing gene, a male infertility gene, a selectable marker gene, a screenable marker gene, a negative selectable marker gene, a gene that affects agronomic characteristics of a plant, an environmental or stress resistant gene, and the like. [7" claim-type="Currently amended] The method of claim 1, wherein the Coix promoter is gamma agent, oleosine ole16, globulin 1, actin 1, actin c1, stroz synthase, INOPS, EMB5, globulin 2, b-32, ADPG-pyrophosphorylase, Ltp1 , Ltp2, oleosin ole17, oleosin ole18, actin 2, pollen specific protein, pollen specific pectase lyase, anther specific protein, anther specific gene RTS2, pollen specific gene, carpet tissue specific gene RAB24, Anthranilate synthase alpha subunit, alpha zein, anthranilate synthase beta subunit, dihydrodipicolinate synthase, Thi1, alcohol dehydrogenase, cab binding protein, H3C4, RUBISCO SS starch branching enzyme, ACCase, Actin3, actin7, regulatory protein GF'14-12, ribosomal protein L9, cellulose biosynthesis enzyme, S-adenosyl-L-homocysteine hydrolase, superoxide dismutase, C-kinase receptor, Force Poglycerate mutases, root-specific RCc3 mRNA, glucose-6-phosphate isomerase, pyrophosphate-furactose 6-phosphate 1 phosphotransferase, ubiquinone, beta-ketoacyl-ACP synthase, 33kDa Photosystem II, Oxygen-releasing Protein, 69kDa Fear ATPase Subunit, Metallothionene-type Protein, Glyceraldehyde-3-Phosphate Dehydrogenase, ABA- and Mature Inducible Analogue Protein, Phenylalanine Ammonia Soluble, Adenosine Triphosphate S Adenosyl-L-homocysteine hydrase, α-tubulin, cab, PEPCase, R, lectin, light harvesting complex, heat shock protein, chalcone synthase, zein, globulin-1, auxin-binding protein, UDP glucose flavonoid And a promoter taken from the Coix gene homologous to a gene selected from glycosyl-transferase gene, MPI, oleosin, actin, opac 2, b70, oleosin and the like. [8" claim-type="Currently amended] The method of claim 1 wherein the Coix promoter is a gamma coicin promoter. [9" claim-type="Currently amended] In the method of producing offspring, (a) preparing a monocotyledonous plant according to the method of claim 1; And (b) a method consisting of crossing a plant with a second plant or itself. [10" claim-type="Currently amended] In the method of plant breeding, (a) preparing a monocotyledonous plant according to the method of claim 9; And (b) a method consisting of crossing a plant with a second plant or itself. [11" claim-type="Currently amended] In a method for preventing gene silencing in monocotyledonous plants other than Coix, (a) providing a Coix promoter; (b) preparing a construct consisting of selected genes operably linked to a Coix promoter; (c) transforming the recipient cells of the monocotyledonous plant other than Coix with the construct of (b); (d) regenerating monocotyledonous plants expressing a gene selected from a recipient cell, wherein the plant does not exhibit gene silencing. [12" claim-type="Currently amended] 12. The method of claim 11, wherein the monocotyledonous plant is a plant selected from rice, wheat, oats, barley, rye, sugar cane and corn. [13" claim-type="Currently amended] 13. The method of claim 12, wherein the monocotyledonous plant is corn. [14" claim-type="Currently amended] 12. The method of claim 11, wherein the transforming step comprises microprojectile bombardment, PEG mediated plasma transformation, electroporation, silicon carbide fiber mediated transformation, or Agrobacterium-mediated transformation. [15" claim-type="Currently amended] 15. The method of claim 14, wherein the microdroplet bombardment consists of coating the microdropper with DNA consisting of the construct and contacting the recipient cell with the microdropper. [16" claim-type="Currently amended] The gene of claim 11, wherein the selected gene is an insect resistance gene, a fungal disease resistance gene, a viral disease resistance gene, a bacterial disease resistance gene, an insecticide resistance gene, a gene affecting grain composition or quality, a gene using nutrients, A method comprising a gene selected from a fungal toxin reducing gene, a male infertility gene, a selectable marker gene, a screenable marker gene, a negative selectable marker gene, a gene that affects agronomic characteristics of a plant, an environmental or stress resistant gene, and the like. [17" claim-type="Currently amended] 12. The Coix promoter of claim 11, wherein the Coix promoter is gamma agent, oleosin ole16, globulin 1, actin 1, actin c1, stroz synthase, INOPS, EMB5, globulin 2, b-32, ADPG-pyrophosphorylase, Ltp1 , Ltp2, oleosin ole17, oleosin ole18, actin 2, pollen specific protein, pollen specific pectase lyase, anther specific protein, anther specific gene RTS2, pollen specific gene, carpet tissue specific gene RAB24, Anthranilate synthase alpha subunit, alpha zein, anthranilate synthase beta subunit, dihydrodipicolinate synthase, Thi1, alcohol dehydrogenase, cab binding protein, H3C4, RUBISCO SS starch branching enzyme, ACCase, Actin3, actin7, regulatory protein GF'14-12, ribosomal protein L9, cellulose biosynthesis enzyme, S-adenosyl-L-homocysteine hydrolase, superoxide dismutase, C-kinase receptor, artillery Poglycerate mutases, root-specific RCc3 mRNA, glucose-6-phosphate isomerase, pyrophosphate-furactose 6-phosphate 1 phosphotransferase, ubiquinone, beta-ketoacyl-ACP synthase, 33kDa Photosystem II, Oxygen-releasing Protein, 69kDa Fear ATPase Subunit, Metallothionene-type Protein, Glyceraldehyde-3-Phosphate Dehydrogenase, ABA- and Mature Inducible Analogue Protein, Phenylalanine Ammonia Soluble, Adenosine Triphosphate S Adenosyl-L-homocysteine hydrase, α-tubulin, cab, PEPCase, R, lectin, light harvesting complex, heat shock protein, chalcone synthase, zein, globulin-1, auxin-binding protein, UDP glucose flavonoid And a promoter taken from the Coix gene homologous to a gene selected from glycosyl-transferase gene, MPI, oleosin, actin, opac 2, b70, oleosin and the like. [18" claim-type="Currently amended] 18. The method of claim 17, comprising hybridizing to DNA from a gene of a monocotyledonous species other than Coix or DNA derived therefrom from the flax sequence. [19" claim-type="Currently amended] 19. The method of claim 18, wherein the monocotyledonous species other than Coix and the monocotyledonous plant other than Coix are members of the same species. [20" claim-type="Currently amended] 19. The method of claim 18, wherein the DNA obtained from Coix consists of a genomic DNA clone library. [21" claim-type="Currently amended] The method of claim 11, wherein providing a Coix promoter consists of a PCR ™ . [22" claim-type="Currently amended] In the method of producing offspring, (a) preparing a monocotyledonous plant according to the method of claim 11; And (b) a method consisting of crossing a plant with a second plant or itself. [23" claim-type="Currently amended] In the method of plant breeding, (a) preparing a monocotyledonous plant according to the method of claim 22; And (b) a method consisting of crossing a plant with a second plant or itself. [24" claim-type="Currently amended] In the method of preparing a monocotyledonous expression vector, (a) identifying a first promoter with a desired expression profile from monocots other than Coix; (b) separating the Coix promoter homologous to the first promoter; (c) constructing an expression vector consisting of Coix promoters operably linked to the selected genes. [25" claim-type="Currently amended] 25. The method of claim 24, wherein the monocotyledonous plant is a plant selected from rice, wheat, oats, barley, rye, sugar cane and corn. [26" claim-type="Currently amended] 26. The method of claim 25, wherein the monocotyledonous plant is corn. [27" claim-type="Currently amended] The gene of claim 24, wherein the selected gene is an insect resistance gene, a fungal disease resistance gene, a viral disease resistance gene, a bacterial disease resistance gene, an insecticide resistance gene, a gene affecting grain composition or quality, a gene using nutrients, A method comprising a gene selected from a fungal toxin reducing gene, a male infertility gene, a selectable marker gene, a screenable marker gene, a negative selectable marker gene, a gene that affects agronomic characteristics of a plant, an environmental or stress resistant gene, and the like. [28" claim-type="Currently amended] The method of claim 24, wherein the Coix promoter is gamma agent, oleosine ole16, globulin1, actin1, actin c1, stroz synthase, INOPS, EMB5, globulin2, b-32, ADPG-pyrophosphorylase, Ltp1 , Ltp2, oleosin ole17, oleosin ole18, actin 2, pollen specific protein, pollen specific pectase lyase, anther specific protein, anther specific gene RTS2, pollen specific gene, carpet tissue specific gene RAB24, Anthranilate synthase alpha subunit, alpha zein, anthranilate synthase beta subunit, dihydrodipicolinate synthase, Thi1, alcohol dehydrogenase, cab binding protein, H3C4, RUBISCO SS starch branching enzyme, ACCase, Actin3, actin7, regulatory protein GF'14-12, ribosomal protein L9, cellulose biosynthesis enzyme, S-adenosyl-L-homocysteine hydrolase, superoxide dismutase, C-kinase receptor, artillery Poglycerate mutases, root-specific RCc3 mRNA, glucose-6-phosphate isomerase, pyrophosphate-furactose 6-phosphate 1 phosphotransferase, ubiquinone, beta-ketoacyl-ACP synthase, 33kDa Photosystem II, Oxygen-releasing Protein, 69kDa Fear ATPase Subunit, Metallothionene-type Protein, Glyceraldehyde-3-Phosphate Dehydrogenase, ABA- and Mature Inducible Analogue Protein, Phenylalanine Ammonia Soluble, Adenosine Triphosphate S Adenosyl-L-homocysteine hydrase, α-tubulin, cab, PEPCase, R, lectin, light harvesting complex, heat shock protein, chalcone synthase, zein, globulin-1, auxin-binding protein, UDP glucose flavonoid And a promoter taken from the Coix gene homologous to a gene selected from glycosyl-transferase gene, MPI, oleosin, actin, opac 2, b70, oleosin and the like. [29" claim-type="Currently amended] 18. The method of claim 17, comprising hybridizing to DNA from a gene of a monocotyledonous species other than Coix or DNA derived therefrom from the flax sequence. [30" claim-type="Currently amended] The method of claim 29, wherein the DNA obtained from Coix consists of a genomic DNA clone library. [31" claim-type="Currently amended] The method of claim 28, wherein providing the Coix promoter consists of a PCR ™ . [32" claim-type="Currently amended] A gamma coicin promoter separable from the nucleic acid sequence of SEQ ID NO: 8. [33" claim-type="Currently amended] An isolated nucleic acid sequence consisting of about 40 to about 894 consecutive nucleotides of SEQ ID NO: 8. [34" claim-type="Currently amended] The isolated nucleic acid sequence of claim 33, wherein the nucleic acid sequence consists of about 222 to about 894 consecutive nucleotides of SEQ ID NO: 8. [35" claim-type="Currently amended] The isolated nucleic acid sequence of claim 34, consisting of the nucleic acid sequence of SEQ ID NO: 8. [36" claim-type="Currently amended] The isolated nucleic acid sequence of claim 35, wherein the nucleic acid sequence consists of about 412 to about 894 consecutive nucleotides of SEQ ID NO: 8. [37" claim-type="Currently amended] The isolated nucleic acid sequence of claim 36, consisting of the nucleic acid sequence of SEQ ID NO: 19. [38" claim-type="Currently amended] A gamma coycin terminator separable from the nucleic acid sequence of SEQ ID NO: 11. [39" claim-type="Currently amended] An isolated nucleic acid sequence consisting of about 80 to about 412 contiguous nucleotides of SEQ ID NO: 11. [40" claim-type="Currently amended] 40. The isolated nucleic acid sequence of claim 39, comprising about 200 to about 412 contiguous nucleotides of SEQ ID NO: 11. [41" claim-type="Currently amended] The isolated nucleic acid sequence of claim 40, wherein the nucleic acid sequence consists of about 325 to about 412 consecutive nucleotides of SEQ ID NO: 11. [42" claim-type="Currently amended] 42. The isolated nucleic acid sequence of claim 41, wherein the nucleic acid sequence consists of the nucleic acid sequence of SEQ ID NO: 11. [43" claim-type="Currently amended] Coix oleosin 3 terminator separable from the nucleic acid sequence of SEQ ID NO: 17. [44" claim-type="Currently amended] An isolated nucleic acid sequence consisting of about 50 to about 377 consecutive nucleotides of SEQ ID NO: 17. [45" claim-type="Currently amended] 45. The isolated nucleic acid sequence of claim 44, which consists of about 120 to about 377 consecutive nucleotides of SEQ ID NO: 17. [46" claim-type="Currently amended] 45. The isolated nucleic acid sequence of claim 44, which consists of about 220 to about 377 consecutive nucleotides of SEQ ID NO: 17. [47" claim-type="Currently amended] 49. The isolated nucleic acid sequence of claim 46, which consists of about 300 to about 377 consecutive nucleotides of SEQ ID NO: 17. [48" claim-type="Currently amended] 48. The isolated nucleic acid sequence of claim 47 consisting of the nucleic acid sequence of SEQ ID NO: 17. [49" claim-type="Currently amended] A modifiable transformed plant composed of the selected DNAs, wherein the selected DNA is composed of a gamma coicin promoter. [50" claim-type="Currently amended] The promoter of claim 49, wherein the promoter comprises a nucleic acid sequence selected from the group consisting of the nucleic acid sequence of claim 32, the nucleic acid sequence of claim 33, the nucleic acid sequence of claim 34, the nucleic acid sequence of claim 35, and the nucleic acid sequence of claim 36. plant. [51" claim-type="Currently amended] 51. The gene of claim 50 wherein the selected genes are insect resistance genes, disease resistance genes, insecticide resistance genes, genes affecting grain composition or quality, genes using nutrients, mycotoxin reduction genes, male infertility genes, selectable marker genes, A plant characterized by consisting of genes selected from screenable marker genes, negative selectable marker genes, genes affecting agronomic characteristics of plants, environmental or stress resistant genes, and the like. [52" claim-type="Currently amended] In a modifiable transformed plant consisting of selected DNAs, the selected DNA is a modifiable trait comprising a gene encoding a gamma coycin that is operably linked to a promoter that is not unique to the gamma coicin gene. Transformed plant. [53" claim-type="Currently amended] 53. The plant of claim 52, wherein the gene encoding gamma coicin encodes a polypeptide encoded by the nucleic acid sequence of SEQ ID NO: 16. [54" claim-type="Currently amended] A modifiable transformed plant composed of selected DNAs, wherein the selected DNA is composed of a gamma coicin terminator. [55" claim-type="Currently amended] 55. The plant of claim 54, wherein the gamma coicin terminator consists of a nucleic acid sequence selected from the group consisting of the nucleic acid sequence of claim 39, the nucleic acid sequence of claim 40, the nucleic acid sequence of claim 41, and the nucleic acid sequence of claim 42. [56" claim-type="Currently amended] A modifiable transformed plant composed of selected DNAs, wherein the selected DNA is composed of Coix oleosin 3 terminator. [57" claim-type="Currently amended] 59. The method of claim 56, wherein the gamma coicin terminator consists of a nucleic acid sequence selected from the group consisting of the nucleic acid sequence of claim 44, the nucleic acid sequence of claim 45, the nucleic acid sequence of claim 46, the nucleic acid sequence of claim 47, and the nucleic acid sequence of claim 48 Plant characterized in that. [58" claim-type="Currently amended] 59. A descendant plant of any generation of the plant according to claim 49, 52, 54 or 56, wherein the descendant plant consists of selected DNA. [59" claim-type="Currently amended] 59. The plant according to claim 49, 52, 54 or 56, wherein the plant is a monocotyledonous plant selected from rice, wheat, barley, rye, sugar cane and corn. [60" claim-type="Currently amended] 60. The plant of claim 59, wherein the monocotyledonous plant is corn. [61" claim-type="Currently amended] 59. The plant according to claim 49, 52, 54 or 56, wherein the plant is a dicotyledonous plant selected from tobacco, tomato, potato, soybean and cotton. [62" claim-type="Currently amended] 59. A method for plant breeding, characterized in that it consists of mating a modifiable transformed plant according to claim 49, 52, 54, or 56 with a second plant or a self-plant. [63" claim-type="Currently amended] Oleosin ole16, globulin1, actin1, actin c1, streptosynthesis, INOPS, EMB5, globulin2, b-32, ADPG-pyrophosphorylase, Ltp1, Ltp2, oleosine ole17, oleosine ole18, actin 2, pollen specific protein, pollen specific pectase lyase, anther specific protein, anther specific gene RTS2, pollen specific gene, carpet tissue specific gene RAB24, anthranilate synthase alpha subunit, alpha zein, anthra Nylate synthase beta subunit, dihydrodipicolinate synthase, Thi1, alcohol dehydrogenase, cab binding protein, H3C4, RUBISCO SS starch branching enzyme, ACCase, actin 3, actin 7, regulatory protein GF'14- 12, ribosomal protein L9, cellulose biosynthesis enzyme, S-adenosyl-L-homocysteine hydrolase, superoxide dismutase, C-kinase receptor, phosphoglycerate mutase, root-specific RCc3 mR NA, Glucose-6-Phosphate Isomerase, Pyrophosphate-Puractose 6-Phosphate1-Phosphotsperase, Ubiquinone, Beta-Ketoacyl-ACP Synthetase, 33kDa Photosystem II, Oxygen Release Protein, 69kDa Fear ATPase Subunit, metallothioneenic protein, glyceraldehyde-3-phosphate dehydrogenase, ABA- and mature inducible analogue protein, phenylalanine ammonia lyase, adenosine triphosphate S-adenosyl-L-homocysteine hydrase, α Tubulin, cab, PEPCase, R, lectin, light harvesting complex, heat shock protein, chalcone synthase, zein, globulin-1, auxin-binding protein, UDP glucose flavonoid glycosyl-transferase gene, MPI, oleosin, An isolated nucleic acid sequence, which encodes a Coix gene selected from actin, opac 2, b70.
类似技术:
公开号 | 公开日 | 专利标题 US10125372B2|2018-11-13|AP2 domain transcription factor ODP2 | and methods of use US8597913B2|2013-12-03|Method of constructing an expression cassette comprising regulatory sequences of a target gene of a plant for expressing gene products US5583210A|1996-12-10|Methods and compositions for controlling plant development US7220894B2|2007-05-22|“Methods of using leci transcriptional activator nucleic acids” US8115058B2|2012-02-14|Rice promoters for regulation of plant expression AU769488B2|2004-01-29|Cyclin D polynucleotides, polypeptides and uses thereof EP2308984B1|2016-04-27|Embryo sac-specific genes US6265637B1|2001-07-24|Genetic control of flowering CA2431647C|2014-11-18|Maize chloroplast aldolase promoter compositions and methods for use thereof US6207879B1|2001-03-27|Maize RS81 promoter and methods for use thereof CA2429697C|2012-07-17|Seed-preferred regulatory elements and uses thereof US7663027B2|2010-02-16|Nucleotide sequences and corresponding polypeptides conferring modulated plant size and biomass in plants EP1737965B1|2011-03-30|Nucleotide sequences and polypeptides encoded thereby useful for modifying nitrogen use efficiency characteristics in plants US6194636B1|2001-02-27|Maize RS324 promoter and methods for use thereof US7402667B2|2008-07-22|Promoter, promoter control elements, and combinations, and uses thereof US7256322B2|2007-08-14|Wuschel | Gene Homologs JP5355286B2|2013-11-27|Plant artificial chromosome, its use and method for producing plant artificial chromosome US7173121B2|2007-02-06|Promoter, promoter control elements, and combinations, and uses thereof Chatterjee et al.1996|DAG, a gene required for chloroplast differentiation and palisade development in Antirrhinum majus. US6946586B1|2005-09-20|Genetic trait breeding method US6583338B2|2003-06-24|Maize A3 promoter and methods for use thereof EP2123764B1|2013-01-09|The rice actin 2 intron and methods for use thereof US9029523B2|2015-05-12|Promoter, promoter control elements, and combinations, and uses thereof US7446241B2|2008-11-04|Transcription factors, DNA and methods for introduction of value-added seed traits and stress tolerance US20090181851A1|2009-07-16|Promoter, Promoter Control Elements, And Combinations, And Uses Thereof
同族专利:
公开号 | 公开日 ZA200006576B|2002-04-24| PT1076706E|2008-05-09| US20090013423A1|2009-01-08| JP2011101653A|2011-05-26| WO1999058659A9|2000-10-12| IN2000DE00321A|2008-06-20| ID27936A|2001-05-03| DE69938101T2|2009-06-18| TR200100104T2|2001-06-21| EP1076706B1|2008-02-06| IL139568D0|2002-02-10| US7803928B2|2010-09-28| JP2002533057A|2002-10-08| DE69938101D1|2008-03-20| CA2328129C|2012-12-11| BR9910455A|2001-11-27| WO1999058659A2|1999-11-18| AU3995799A|1999-11-29| WO1999058659A3|2000-01-20| US7803927B2|2010-09-28| US20090199307A1|2009-08-06| AT385518T|2008-02-15| CA2328129A1|1999-11-18| AR072694A2|2010-09-15| DK1076706T3|2008-05-13| MX236322B|2006-04-28| EP1076706A2|2001-02-21| IN2005DE05625A|2007-09-28| US6635806B1|2003-10-21| US20050250938A1|2005-11-10| US7256283B2|2007-08-14| MXPA00011199A|2001-04-01| CN1310760A|2001-08-29| ES2301239T3|2008-06-16| AR020075A1|2002-04-10| US7741538B2|2010-06-22| US20080271212A1|2008-10-30|
引用文献:
公开号 | 申请日 | 公开日 | 申请人 | 专利标题
法律状态:
1998-05-14|Priority to US9/078,972 1998-05-14|Priority to US09/078,972 1999-05-14|Application filed by 데칼브 제네틱스 코오퍼레이션 1999-05-14|Priority to PCT/US1999/010776 2001-06-25|Publication of KR20010052350A
优先权:
[返回顶部]
申请号 | 申请日 | 专利标题 US9/078,972|1998-05-14| US09/078,972|US6635806B1|1998-05-14|1998-05-14|Methods and compositions for expression of transgenes in plants| PCT/US1999/010776|WO1999058659A2|1998-05-14|1999-05-14|Methods and compositions for expression of transgenes in plants| 相关专利
Sulfonates, polymers, resist compositions and patterning process
Washing machine
Washing machine
Device for fixture finishing and tension adjusting of membrane
Structure for Equipping Band in a Plane Cathode Ray Tube
Process for preparation of 7 alpha-carboxyl 9, 11-epoxy steroids and intermediates useful therein an
国家/地区
|